ID: 1198984081

View in Genome Browser
Species Human (GRCh38)
Location X:142429256-142429278
Sequence GGTGCCAAGCAATGACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198984080_1198984081 -10 Left 1198984080 X:142429243-142429265 CCTTAATTTGCAGGGTGCCAAGC No data
Right 1198984081 X:142429256-142429278 GGTGCCAAGCAATGACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198984081 Original CRISPR GGTGCCAAGCAATGACAAAC AGG Intergenic
No off target data available for this crispr