ID: 1198993626

View in Genome Browser
Species Human (GRCh38)
Location X:142546714-142546736
Sequence TTAAGCAAAAAGACTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198993626_1198993629 11 Left 1198993626 X:142546714-142546736 CCAACCTAAGTCTTTTTGCTTAA No data
Right 1198993629 X:142546748-142546770 ACAGGAGAGATTGATTTGCAAGG No data
1198993626_1198993628 -7 Left 1198993626 X:142546714-142546736 CCAACCTAAGTCTTTTTGCTTAA No data
Right 1198993628 X:142546730-142546752 TGCTTAAACACATCTGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198993626 Original CRISPR TTAAGCAAAAAGACTTAGGT TGG (reversed) Intergenic
No off target data available for this crispr