ID: 1198995118

View in Genome Browser
Species Human (GRCh38)
Location X:142566123-142566145
Sequence TAGGTAGGCATTCCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198995113_1198995118 21 Left 1198995113 X:142566079-142566101 CCTTGGTGGGCTTGGATAAGATC No data
Right 1198995118 X:142566123-142566145 TAGGTAGGCATTCCTGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198995118 Original CRISPR TAGGTAGGCATTCCTGTTCC TGG Intergenic
No off target data available for this crispr