ID: 1198998341

View in Genome Browser
Species Human (GRCh38)
Location X:142602866-142602888
Sequence TGTCCTTTGCAGAACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198998341_1198998343 1 Left 1198998341 X:142602866-142602888 CCATCCATGTTCTGCAAAGGACA No data
Right 1198998343 X:142602890-142602912 CATCTCATTCCTTTATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198998341 Original CRISPR TGTCCTTTGCAGAACATGGA TGG (reversed) Intergenic
No off target data available for this crispr