ID: 1198999982

View in Genome Browser
Species Human (GRCh38)
Location X:142624256-142624278
Sequence TTGCCATGACAACGCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198999979_1198999982 4 Left 1198999979 X:142624229-142624251 CCAGATCTCAGGATAACTCTCTC No data
Right 1198999982 X:142624256-142624278 TTGCCATGACAACGCCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198999982 Original CRISPR TTGCCATGACAACGCCAAAG GGG Intergenic
No off target data available for this crispr