ID: 1199008504

View in Genome Browser
Species Human (GRCh38)
Location X:142730855-142730877
Sequence AGTTATCTCCAGAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199008504_1199008508 15 Left 1199008504 X:142730855-142730877 CCTGCCATCCTCTGGAGATAACT No data
Right 1199008508 X:142730893-142730915 AACATCTTTTTGCCTGCCACTGG No data
1199008504_1199008509 16 Left 1199008504 X:142730855-142730877 CCTGCCATCCTCTGGAGATAACT No data
Right 1199008509 X:142730894-142730916 ACATCTTTTTGCCTGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199008504 Original CRISPR AGTTATCTCCAGAGGATGGC AGG (reversed) Intergenic
No off target data available for this crispr