ID: 1199008509

View in Genome Browser
Species Human (GRCh38)
Location X:142730894-142730916
Sequence ACATCTTTTTGCCTGCCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199008506_1199008509 8 Left 1199008506 X:142730863-142730885 CCTCTGGAGATAACTACTCTCCT No data
Right 1199008509 X:142730894-142730916 ACATCTTTTTGCCTGCCACTGGG No data
1199008504_1199008509 16 Left 1199008504 X:142730855-142730877 CCTGCCATCCTCTGGAGATAACT No data
Right 1199008509 X:142730894-142730916 ACATCTTTTTGCCTGCCACTGGG No data
1199008505_1199008509 12 Left 1199008505 X:142730859-142730881 CCATCCTCTGGAGATAACTACTC No data
Right 1199008509 X:142730894-142730916 ACATCTTTTTGCCTGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199008509 Original CRISPR ACATCTTTTTGCCTGCCACT GGG Intergenic
No off target data available for this crispr