ID: 1199012611

View in Genome Browser
Species Human (GRCh38)
Location X:142775677-142775699
Sequence AAGAAGAAGAGAGGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199012611_1199012616 27 Left 1199012611 X:142775677-142775699 CCTTCTCTCCCTCTCTTCTTCTT No data
Right 1199012616 X:142775727-142775749 ACAGCTCTTTCAGTTTCCCCAGG No data
1199012611_1199012615 -3 Left 1199012611 X:142775677-142775699 CCTTCTCTCCCTCTCTTCTTCTT No data
Right 1199012615 X:142775697-142775719 CTTTTGGAGTCAGATATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199012611 Original CRISPR AAGAAGAAGAGAGGGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr