ID: 1199012613

View in Genome Browser
Species Human (GRCh38)
Location X:142775685-142775707
Sequence GACTCCAAAAGAAGAAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199012613_1199012616 19 Left 1199012613 X:142775685-142775707 CCCTCTCTTCTTCTTTTGGAGTC No data
Right 1199012616 X:142775727-142775749 ACAGCTCTTTCAGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199012613 Original CRISPR GACTCCAAAAGAAGAAGAGA GGG (reversed) Intergenic
No off target data available for this crispr