ID: 1199012614

View in Genome Browser
Species Human (GRCh38)
Location X:142775686-142775708
Sequence TGACTCCAAAAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199012614_1199012616 18 Left 1199012614 X:142775686-142775708 CCTCTCTTCTTCTTTTGGAGTCA No data
Right 1199012616 X:142775727-142775749 ACAGCTCTTTCAGTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199012614 Original CRISPR TGACTCCAAAAGAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr