ID: 1199012793

View in Genome Browser
Species Human (GRCh38)
Location X:142777293-142777315
Sequence CTGTAGACATGAATGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199012790_1199012793 2 Left 1199012790 X:142777268-142777290 CCAAAAGGGCTTGATCTGCAGGG No data
Right 1199012793 X:142777293-142777315 CTGTAGACATGAATGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199012793 Original CRISPR CTGTAGACATGAATGGAACA TGG Intergenic
No off target data available for this crispr