ID: 1199016225

View in Genome Browser
Species Human (GRCh38)
Location X:142819463-142819485
Sequence GGGAGAACTCCCTGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199016216_1199016225 8 Left 1199016216 X:142819432-142819454 CCAGCATTCCCCATGGATGTGTG No data
Right 1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG No data
1199016215_1199016225 9 Left 1199016215 X:142819431-142819453 CCCAGCATTCCCCATGGATGTGT No data
Right 1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG No data
1199016218_1199016225 -1 Left 1199016218 X:142819441-142819463 CCCATGGATGTGTGAGCTAGCAG No data
Right 1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG No data
1199016219_1199016225 -2 Left 1199016219 X:142819442-142819464 CCATGGATGTGTGAGCTAGCAGG No data
Right 1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG No data
1199016217_1199016225 0 Left 1199016217 X:142819440-142819462 CCCCATGGATGTGTGAGCTAGCA No data
Right 1199016225 X:142819463-142819485 GGGAGAACTCCCTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199016225 Original CRISPR GGGAGAACTCCCTGGGGAGC AGG Intergenic
No off target data available for this crispr