ID: 1199021642

View in Genome Browser
Species Human (GRCh38)
Location X:142885153-142885175
Sequence CTATATCAGCCGAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199021642_1199021644 3 Left 1199021642 X:142885153-142885175 CCTGCCTGCTTCGGCTGATATAG No data
Right 1199021644 X:142885179-142885201 ATCTCATTTTCTCTGACCCTTGG No data
1199021642_1199021645 8 Left 1199021642 X:142885153-142885175 CCTGCCTGCTTCGGCTGATATAG No data
Right 1199021645 X:142885184-142885206 ATTTTCTCTGACCCTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199021642 Original CRISPR CTATATCAGCCGAAGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr