ID: 1199024376

View in Genome Browser
Species Human (GRCh38)
Location X:142919687-142919709
Sequence ACTTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199024376_1199024378 4 Left 1199024376 X:142919687-142919709 CCTGCCATCTTCTGCAGATAAGT No data
Right 1199024378 X:142919714-142919736 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1199024376_1199024382 25 Left 1199024376 X:142919687-142919709 CCTGCCATCTTCTGCAGATAAGT No data
Right 1199024382 X:142919735-142919757 GGACTGTTACCGGGCTTTAGTGG No data
1199024376_1199024381 16 Left 1199024376 X:142919687-142919709 CCTGCCATCTTCTGCAGATAAGT No data
Right 1199024381 X:142919726-142919748 ACAGCTCTTGGACTGTTACCGGG No data
1199024376_1199024380 15 Left 1199024376 X:142919687-142919709 CCTGCCATCTTCTGCAGATAAGT No data
Right 1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199024376 Original CRISPR ACTTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr