ID: 1199024380

View in Genome Browser
Species Human (GRCh38)
Location X:142919725-142919747
Sequence GACAGCTCTTGGACTGTTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199024376_1199024380 15 Left 1199024376 X:142919687-142919709 CCTGCCATCTTCTGCAGATAAGT No data
Right 1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG No data
1199024377_1199024380 11 Left 1199024377 X:142919691-142919713 CCATCTTCTGCAGATAAGTACTC No data
Right 1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199024380 Original CRISPR GACAGCTCTTGGACTGTTAC CGG Intergenic
No off target data available for this crispr