ID: 1199026914

View in Genome Browser
Species Human (GRCh38)
Location X:142950359-142950381
Sequence TCTAATATCCAGACTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199026914_1199026915 -9 Left 1199026914 X:142950359-142950381 CCTTGCACAGTCTGGATATTAGA No data
Right 1199026915 X:142950373-142950395 GATATTAGACCTTTGTCAGATGG 0: 1067
1: 5495
2: 3396
3: 1556
4: 1281
1199026914_1199026917 23 Left 1199026914 X:142950359-142950381 CCTTGCACAGTCTGGATATTAGA No data
Right 1199026917 X:142950405-142950427 AAAATTTTCTCCCATTCTGTAGG 0: 8879
1: 14882
2: 10936
3: 7247
4: 5330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199026914 Original CRISPR TCTAATATCCAGACTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr