ID: 1199033712

View in Genome Browser
Species Human (GRCh38)
Location X:143028894-143028916
Sequence AGCTTTTAAAAGCTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 6, 3: 22, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199033709_1199033712 -1 Left 1199033709 X:143028872-143028894 CCATGGTCGAAGAATGTATTTAA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG 0: 1
1: 1
2: 6
3: 22
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199033712 Original CRISPR AGCTTTTAAAAGCTGGAGTA GGG Intronic
901244573 1:7719567-7719589 AGTTTTCAAAAAGTGGAGTATGG + Intronic
902455654 1:16532320-16532342 CGCTTTGAAAGGCTGAAGTAGGG - Intergenic
904070547 1:27793028-27793050 AGCTTTTTAAAGCAAGAGCATGG + Intronic
904237722 1:29125042-29125064 GGCTTTTAAGAGCTGGAAGAGGG - Intergenic
904866301 1:33581668-33581690 AGCTTTCAAAAGCAGTATTAGGG - Intronic
907348080 1:53800858-53800880 ACATTTTAAAAGCTGGTGTTTGG - Intronic
908782150 1:67700500-67700522 AGTTTTTAAAAGATGGGGGAAGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
912665610 1:111576829-111576851 AGCTTTAGGAAGCGGGAGTATGG + Intronic
913124108 1:115769424-115769446 AGCTGTTAAAAGGCAGAGTAGGG - Intergenic
915267198 1:154727427-154727449 AGCTTCTAAAAGAGAGAGTAGGG - Intronic
915757206 1:158273685-158273707 ATCTTTTAAAAGATGGAGCCAGG - Intergenic
916275324 1:162987724-162987746 AGCTTTGAAAGGCTGAAGTGAGG - Intergenic
918702696 1:187625322-187625344 AGTTTTTAAGAGCTAGGGTAGGG - Intergenic
919023546 1:192139305-192139327 AGCTTTTAAAAGTGAGAATATGG - Intergenic
919264585 1:195245578-195245600 AGCTATTAAATGGTAGAGTAGGG + Intergenic
919964862 1:202512797-202512819 TGTTTTTAAAAAGTGGAGTAGGG - Intronic
922478949 1:225925174-225925196 AGCTTTTAAAAGCAAGAGACAGG - Intergenic
922610771 1:226925464-226925486 AGCATTTAAGAACTGGAGAATGG + Intronic
923694747 1:236236925-236236947 AACTTTTAAAAACTAGAGCATGG - Intronic
923696737 1:236260275-236260297 AGCCTACAAAAGCTGGAGTAAGG + Intronic
923931069 1:238697731-238697753 AGCTTTGAAATGCTGGATAAAGG - Intergenic
924654536 1:245961629-245961651 TGTTTTTAAGAGCTGGAGTGGGG - Intronic
1064217762 10:13414930-13414952 TGCTTTTAAAATCTGGACTCTGG + Intergenic
1064765748 10:18669690-18669712 ACCTTTTAAAAATTGGAGTTGGG + Intronic
1065070332 10:22017189-22017211 AGCTTTTAAAAATCGAAGTAGGG + Intergenic
1065359585 10:24877034-24877056 GGTTTTTAGAAGGTGGAGTAAGG - Intronic
1065771866 10:29085422-29085444 ATCTTTCATAAGCTGGAGTATGG - Intergenic
1067839562 10:49665120-49665142 AGCTGTGGAAAGCTGGGGTAAGG - Intergenic
1068401634 10:56535249-56535271 AGTTTTTAAAAGCTAGGGTCAGG + Intergenic
1068447648 10:57143490-57143512 AGTTTTTGAAAGCTGGGGTCAGG - Intergenic
1069350860 10:67525183-67525205 AGCTTTTTAAAGTTTGAGTTTGG - Intronic
1070904090 10:80056349-80056371 AGCTTTTCAAACCTGGGATATGG - Intergenic
1071956783 10:90769196-90769218 TGCTTTTAAAAACTTGAATATGG - Intronic
1072133712 10:92522698-92522720 AGCTTTTAAGTGCTGGAGTCAGG - Intronic
1073767624 10:106700550-106700572 AGCTTTTCAAAAATAGAGTATGG - Intronic
1075814522 10:125254613-125254635 AGGTTTTAGAAGCTTCAGTAAGG - Intergenic
1076413031 10:130265245-130265267 TGCTATTAAAGGCTGGAGTTGGG - Intergenic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1079122325 11:17695076-17695098 AGCTTTTAGCCGCTGGCGTAGGG - Intergenic
1086415537 11:86585806-86585828 AGCTTTTTAAGGCTGGATAAAGG + Intronic
1086747359 11:90446359-90446381 AGCTTTTAAGAGCTGGGCTGGGG + Intergenic
1087824874 11:102753777-102753799 AGCCTTTGAACTCTGGAGTAAGG - Intergenic
1088998725 11:115030186-115030208 ATTTTTTAAAAGGTGGAGGATGG + Intergenic
1089898415 11:121955892-121955914 AGCAGTGAAGAGCTGGAGTAAGG - Intergenic
1090051047 11:123380011-123380033 ATTTTTTTAAAGCTGGAGAAAGG - Intergenic
1091264033 11:134256402-134256424 AGCCTTTAACAGCTAGAGAATGG - Intronic
1092197727 12:6559972-6559994 AGCATGCAAAGGCTGGAGTAAGG + Intronic
1093934249 12:24984033-24984055 AGGTATTGAAAACTGGAGTAAGG - Intergenic
1094072803 12:26437207-26437229 AGTTTTTAAAAGTTAGAGAATGG - Intronic
1096009387 12:48200129-48200151 AGTTTTTAAGAGCTGCTGTACGG - Intergenic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098536350 12:71597662-71597684 AACTTTTGAAAGTTGGAGTTGGG - Intergenic
1099975441 12:89541429-89541451 AGCTTTTAGTGGCTGGAGTCAGG + Intergenic
1099983498 12:89635126-89635148 AGCTTTCAATGACTGGAGTAAGG - Exonic
1100945424 12:99777883-99777905 AACTTTTAAAAACTGAAGCATGG - Intronic
1101262302 12:103045525-103045547 ACCTTTTTAAAGCTGAAGAATGG - Intergenic
1101762181 12:107667878-107667900 AGCTTTTCAAAGATGGAATGAGG + Intergenic
1102419669 12:112793833-112793855 ATCTTTTAATTGCTGGATTATGG + Intronic
1103190186 12:118994461-118994483 GGCTTTTAAGAACTAGAGTAGGG - Intronic
1104522813 12:129491014-129491036 AGCTTTTGAATGCTGGAATCTGG + Intronic
1105395305 13:20027827-20027849 AGTTTTTCAAATTTGGAGTATGG + Intronic
1106682753 13:32025218-32025240 AGCTTTTATATGATGGAGCATGG + Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108093416 13:46875336-46875358 ACCTTTTAAAAAGTGGAGAATGG + Intronic
1109387990 13:61657613-61657635 AGATTTTAAAAAGTGGAGTTGGG - Intergenic
1110494522 13:76150649-76150671 AGTTTTTAAATGATGGAGTCAGG + Intergenic
1111488119 13:88931315-88931337 AGCTTCTAAAAGCAGGAGTCAGG - Intergenic
1111607777 13:90563308-90563330 AGATTTTAAGAGCTGGTGTGGGG + Intergenic
1112098949 13:96166216-96166238 AGTTTTTAAGAGCTGGAATGGGG + Intronic
1112601032 13:100856214-100856236 AGCTGTGAAAAGCTGAAGAAGGG + Intergenic
1114529533 14:23387283-23387305 AGGTTTTAAAAGTTGGAATCTGG - Intronic
1114541791 14:23466196-23466218 AGTTTTTAAAACCTGCATTAGGG - Intergenic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1118613094 14:67556576-67556598 AGTATTTAAAAGCTGGTGCAGGG - Intronic
1119262257 14:73244782-73244804 AGCTTGTTAAAGCAGGAGCAGGG + Intronic
1119952198 14:78756633-78756655 AATTTTTAAAAGTTGGAGCAAGG - Intronic
1120681724 14:87488130-87488152 AGCTCTTAAAAGTTGAATTAGGG + Intergenic
1121088813 14:91167262-91167284 ATCTTTCAAAAGCTGGAGCAAGG - Exonic
1121898130 14:97667857-97667879 AGCTTGTAAATGCTGGAGCCTGG - Intergenic
1122296892 14:100710946-100710968 AGCTTTAAAAAGCTGCAGTGCGG - Intergenic
1126187260 15:45842275-45842297 AGCTCTGGAAAGCTGGAGTCAGG - Intergenic
1126229720 15:46310605-46310627 AGATTTTAGAAGATGAAGTAAGG + Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127991722 15:64123846-64123868 AGATTTTAAAAGATGGTTTAGGG - Intronic
1128878847 15:71224699-71224721 AGCCTCTCAAAGCTGGAGAAGGG - Intronic
1130615534 15:85403538-85403560 AGCATTTAAAAGCTGATGTGAGG + Intronic
1131965241 15:97835194-97835216 AGCTGGTAAAAGCAGGACTAGGG - Intergenic
1133571982 16:7050070-7050092 AACTGTTAAAAGATGAAGTAGGG - Intronic
1139021301 16:62753157-62753179 AGCTTTTGACAGCTGAAGGATGG - Intergenic
1139387819 16:66585592-66585614 AGCTTCCAAAAGTTGGAGGAGGG + Intronic
1140597484 16:76433783-76433805 AACTGCTAAAAGCTGGAGTAAGG + Intronic
1143280090 17:5747476-5747498 AGCTTAGAAAAGCTGGTGTGTGG - Intergenic
1144363851 17:14522972-14522994 AGATTCTAAAAGCTGGATTAGGG - Intergenic
1145995465 17:29102449-29102471 AGCTTAAAAAAGCAGGAGGAGGG + Intronic
1147039806 17:37709863-37709885 AGCTATTAAGAGCTGGAGCTGGG + Intronic
1147213018 17:38883095-38883117 TGCTTTTAAAAGGTGGGGCAGGG + Intronic
1150492320 17:65583004-65583026 AGCTTTTAAATGCTGAAGTTGGG - Intronic
1151008879 17:70470708-70470730 TGCTTTTAAAATCTGTAGAAAGG + Intergenic
1153417433 18:4863121-4863143 TGTTTTTAAAAGCTGGATTCTGG - Intergenic
1154939608 18:21098154-21098176 AGCTTTTAAAATGTCTAGTAGGG - Intronic
1156100974 18:33594411-33594433 AGCTTGTAAAATCAGGACTAAGG + Intronic
1158759285 18:60365510-60365532 AACTTTTAAAAACTCCAGTATGG - Intergenic
1159323056 18:66879548-66879570 AGATATTAAAATCTGGTGTATGG - Intergenic
1159475339 18:68913906-68913928 TGTTTTTAAAAGTTGGATTATGG + Intronic
1159730400 18:72019509-72019531 ATCTTTTAAAAGCTAGAAAATGG + Intergenic
1159918551 18:74206834-74206856 TGCTCTTAAAACCTGAAGTATGG - Intergenic
1162674932 19:12292025-12292047 AGTTTTTAAAAAATGGAATAGGG + Intronic
1163520054 19:17786750-17786772 AGTCTTTAAAAGCTGGAGGAGGG + Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1164232644 19:23303902-23303924 AGCTTCTCAAACCAGGAGTAGGG - Intergenic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1165763944 19:38338446-38338468 AGCTTTAAAAACCTGGAACAAGG - Intronic
1166610725 19:44192692-44192714 AGTATTTTAAAGCTGGAATAAGG + Intergenic
1166666866 19:44685412-44685434 AACTTCTAGAAGCTGGAGGAGGG + Intergenic
928130462 2:28645344-28645366 AGCTCTGAAAAGATGGAGAATGG + Intergenic
928985962 2:37181900-37181922 AGCTATTCAAAGCTGGCTTAGGG + Intronic
929152705 2:38761728-38761750 ACCTTTTAAAAGCTAGGTTAAGG + Intronic
929279318 2:40060840-40060862 AGCTATTAACAGCTGGAGGAAGG - Intergenic
929506487 2:42532054-42532076 AGCATTAAAAAGCTGGATTTTGG - Intronic
930454426 2:51587598-51587620 AGCATTAAAAAGCTTGTGTAAGG + Intergenic
931281642 2:60799087-60799109 AGCTTTCAAAAGTTGAAGTCAGG - Intronic
931281643 2:60799096-60799118 AACTTTTGAAAGCTTTAGTAAGG + Intronic
932228846 2:70065595-70065617 AGCATTTAAAAGCAGGGGCAGGG + Intergenic
934658513 2:96130523-96130545 AGCTTTTTAAAGCTGGGTCAAGG - Intronic
935390097 2:102541988-102542010 AGTTTATAAACTCTGGAGTATGG + Intergenic
935953967 2:108356234-108356256 TGCTTTTAAAATCTGGAATGAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938899912 2:135791188-135791210 AGCCTTTCATAGCTGGTGTAAGG - Intronic
939150334 2:138464923-138464945 ATCATTTAAAAGATGGAATAAGG + Intergenic
940120569 2:150260100-150260122 CGCAGTTAAGAGCTGGAGTAGGG - Intergenic
941335948 2:164243887-164243909 AGCTTCTAAAAGGTAGAGGATGG - Intergenic
942254101 2:174075178-174075200 AGCTTCTACAATTTGGAGTAGGG + Exonic
942532809 2:176930520-176930542 AGCTTTTAAAATATGTTGTAAGG - Intergenic
943727487 2:191267172-191267194 AGCTTTTTAAGGTTGGAGTCAGG + Intronic
945612915 2:212028701-212028723 AGCTTTTAAAGGGTGGAAAAGGG - Intronic
947003506 2:225485555-225485577 AGTGTTTAAAAGCTGGACAATGG + Intronic
947165366 2:227256177-227256199 AGCTTTTAAAAACTGCATTTGGG + Intronic
947559731 2:231138107-231138129 ATCTTTTAAAAGATGGGGTCAGG + Intronic
947777704 2:232727265-232727287 AGTTTTTAAAAGCTGTATGATGG - Intronic
947958501 2:234215071-234215093 AGCGTTTAAAAGCTGGTGCCTGG + Intergenic
1168987808 20:2065257-2065279 AACTAGTACAAGCTGGAGTACGG + Intergenic
1169679560 20:8195539-8195561 TGCTTTTAAAAATTGGACTATGG - Intronic
1169760947 20:9093417-9093439 AGCATATAAAAGCTGGAAAAGGG - Intronic
1170187883 20:13611887-13611909 AGTTTTTAAAAGCTAGTCTATGG + Intronic
1174061130 20:47833825-47833847 AGACTTAAAAAGCTGTAGTACGG + Intergenic
1174070646 20:47896874-47896896 AGACTTAAAAAGCTGTAGTACGG - Intergenic
1175102385 20:56588678-56588700 GGCTTTTAAAAGCTGGAAATGGG - Intergenic
1175364163 20:58439920-58439942 AGCCATTAATAGCTGGAGTTGGG + Intronic
1179003844 21:37491622-37491644 AATTTTTAAAAATTGGAGTAGGG + Intronic
1180072772 21:45444775-45444797 AACTTTTAAAAACTAGGGTATGG - Intronic
1181676308 22:24455720-24455742 AGCTTTGTAAAGCAGGAGAATGG - Intergenic
1181857398 22:25791924-25791946 AGCTTTTAAGTGGTGGAGTCGGG + Intronic
1182819747 22:33205358-33205380 ACTTTTTAAAAGCTGAATTAGGG - Intronic
1182906542 22:33942731-33942753 AGCTTCAAAAAGCTGCAGTCTGG + Intergenic
1184064252 22:42107521-42107543 AGCTTCTATAATTTGGAGTAGGG + Intergenic
949386025 3:3503117-3503139 AGATTTTAAAAGATGGTCTATGG + Intergenic
950374031 3:12555819-12555841 AACTTCAAAATGCTGGAGTAAGG - Intronic
950691238 3:14659840-14659862 AGCTTTGGCAAGCTGGAGAAAGG + Intronic
951061136 3:18208589-18208611 GGTTTTTAAAAGCTGGAGACTGG - Intronic
951305969 3:21062817-21062839 AGCTTCTAAAAGCTGGCCTATGG - Intergenic
951422531 3:22504288-22504310 AGCATTTAAGAACTGGAGCAAGG + Intergenic
952457383 3:33486319-33486341 AGATGTTAAAAGCTGAAGTCTGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953156644 3:40381181-40381203 ACTTTTTAAAAGGTGGAATAAGG + Intergenic
953971555 3:47352418-47352440 ATCTTTTAGAAGCTGGATTATGG + Intergenic
956141294 3:66149239-66149261 AGCTTTCAGGAGCTGGAGTTAGG + Intronic
956589805 3:70902682-70902704 AGATTTTAAAAGGTGGGGTGTGG + Intergenic
957163616 3:76642029-76642051 AGTTTTTAAAAGCTGACGTAGGG + Intronic
957928361 3:86844230-86844252 AGCATTTAAGAGCTGGGGTACGG - Intergenic
959225405 3:103576013-103576035 AGATGTAAGAAGCTGGAGTATGG - Intergenic
959660212 3:108859950-108859972 AGTTTTTAAGAGCTGGGGTGGGG - Intergenic
961028390 3:123581149-123581171 AACTTTTAAAACCTGAACTATGG - Intronic
961867717 3:129965968-129965990 AGGGTTTAGAGGCTGGAGTAGGG - Intergenic
964828803 3:160860155-160860177 AGATTTTAAAATCTGGACTGAGG + Intronic
965426609 3:168532230-168532252 AGCTCTAGAAAGCTGGAGGATGG + Intergenic
970730723 4:19100533-19100555 AGCTTTTAAAAGCAGCAGGGTGG + Intergenic
971541605 4:27824083-27824105 AGCTTTTAATGTCTAGAGTAGGG - Intergenic
971656206 4:29348511-29348533 AGCATTTAAAAGATGAAGCAAGG - Intergenic
971954447 4:33397559-33397581 AGCTTTCTAAACCTGGAGAAAGG + Intergenic
972766307 4:42154576-42154598 AGCTTTTAAAAGTGGGGGGAAGG + Intergenic
975162465 4:71139455-71139477 GGCTTCTAAAAGTTGGAGTTTGG - Intergenic
976201214 4:82580671-82580693 AACTTTCAAAGGCTGGAGAAGGG - Intergenic
976656036 4:87489622-87489644 AGCATTCAAGAGCTGGGGTATGG - Intronic
977447260 4:97146595-97146617 ACCTGTTAAAGGATGGAGTAGGG - Intergenic
977730704 4:100348141-100348163 TGCTTATTAGAGCTGGAGTATGG + Intergenic
977759480 4:100715846-100715868 AGTTTTTAAATGCTGTAGAATGG - Intronic
977938614 4:102834004-102834026 AGCTTTGAAAAGTTGGAGAATGG + Intronic
978040131 4:104050221-104050243 AGCTTTTAAAGGTTAGAATAAGG - Intergenic
979049110 4:115907544-115907566 AACTTTAAAAAGCTGGAAGATGG - Intergenic
979109022 4:116726619-116726641 AGCTTTTAAAAGGTTGAGACAGG + Intergenic
981182989 4:141767770-141767792 AGTTTTTAGGAGCTGGAGTGGGG - Intergenic
981264427 4:142765228-142765250 AGCTTTTAAAAGATTAAGCATGG + Intronic
982291933 4:153789963-153789985 CGCTCTGGAAAGCTGGAGTATGG + Intergenic
982356876 4:154480366-154480388 AGCTTTGAAAAGTTGGAGGACGG + Intronic
982362536 4:154535755-154535777 AGCTATTTAAAGCTGTAGCAAGG - Exonic
982854561 4:160364396-160364418 AGATTTTAAGAGCTGGAGTTGGG - Intergenic
985434926 4:189919427-189919449 AGTTTTTGAAAGCGAGAGTAAGG - Intergenic
988508690 5:31846819-31846841 AGCTGTAAAAAGCTGAAGAAAGG - Intronic
988856166 5:35229981-35230003 AGTTTGTAAAAGCTGGGGTTGGG + Intronic
990090756 5:52044559-52044581 AGCTTTGACATGCTGCAGTAAGG - Intronic
991433048 5:66568282-66568304 AGGGTTTAAGAGCTGGAATAGGG - Intergenic
992998877 5:82359921-82359943 AGCTTTTAATTTCTAGAGTAAGG + Intronic
993504093 5:88690792-88690814 AGCCTTGAAGAGCTGGAGAACGG + Intergenic
993772144 5:91941970-91941992 AGACTTTAACAGCTAGAGTAGGG - Intergenic
994363828 5:98887806-98887828 AGATTTTAAAAACTGAACTAAGG - Intronic
994682001 5:102899807-102899829 ACCTTTTAGAAGCTGGGGTGTGG + Intronic
994714264 5:103302996-103303018 AGCATCTAAAAGTTGGAATAGGG + Intergenic
996618639 5:125472477-125472499 ATCCTTAAAATGCTGGAGTAAGG - Intergenic
996744108 5:126830719-126830741 AGCTTCTAGAAGCTGGAATGTGG + Intronic
997370971 5:133359743-133359765 TGCTTTTAAAAGCTGAATGAGGG - Intronic
999361398 5:150989359-150989381 AGCTTTTAAGAGCTAGAGTAGGG + Intergenic
999672927 5:153973536-153973558 AGCTTTTAAAGACTGGACTCTGG + Intergenic
999828838 5:155299849-155299871 TGCTATTAAAAGCTGGTGTTCGG + Intergenic
1000599733 5:163257881-163257903 AGGTTTTAGAAGCTGGTGGAAGG - Intergenic
1000971473 5:167719455-167719477 AGCTTCGAACAGCTGGAGTGGGG + Intronic
1002771973 6:297739-297761 AGTTATCAAAAGGTGGAGTAGGG + Intronic
1003039130 6:2670808-2670830 AGCTTGTAAAGGGTGGAGTGTGG - Intronic
1004886139 6:20053350-20053372 AGCTTTTAAAATATCCAGTAAGG + Intergenic
1005218199 6:23555973-23555995 AGCTATTATAATCTGGAGAAGGG + Intergenic
1005401156 6:25436148-25436170 AGCTTTTAAAGTCAGGATTATGG + Intronic
1006470239 6:34224443-34224465 AGCTTTTGGAAGCTGGAAAAGGG - Intergenic
1007121732 6:39387912-39387934 AGCTTTTTAATCCTGCAGTATGG + Intronic
1007852020 6:44812438-44812460 AGCTCTTAAAAGCAGAAGAATGG - Intronic
1009449644 6:63786328-63786350 AGAATTTAATAGTTGGAGTAAGG - Intronic
1010486673 6:76422754-76422776 AGTTTTTAAGGGCTGGAGTGAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011452914 6:87514476-87514498 AGCTTTGAAAAGATGAAGTCTGG + Exonic
1011476608 6:87754983-87755005 AGCTTCTAGAAGCTGGAAAAAGG - Intergenic
1011613658 6:89178624-89178646 AGCTTTGGAAAGCTGCAGAAGGG + Exonic
1012021409 6:93925629-93925651 AGCTTTTAGAAGGGGGATTAAGG - Intergenic
1012420771 6:99062598-99062620 AGCATTTAAAAGTTTGAGAATGG - Intergenic
1012537301 6:100314424-100314446 AGCTATTAAATGTTGAAGTAAGG + Intergenic
1013868603 6:114728141-114728163 AGCTTTTAAAAGGAAGAGTCTGG + Intergenic
1016121158 6:140342661-140342683 GGCTTTCAAAAGTTGGAGAAGGG - Intergenic
1016246202 6:141984086-141984108 AGCTTTAAAAAGGTGGAGGGGGG + Intergenic
1016814518 6:148291378-148291400 AGCTTTTAAAAAGTGCAGGATGG + Intronic
1017265527 6:152440865-152440887 AGTTTTTAAAATCTGGAGGCAGG - Intronic
1018174338 6:161165948-161165970 AGTTTTTAAAAAATGGAGTGTGG + Intronic
1018403560 6:163451989-163452011 AACTTTTAAAAACAGGATTATGG + Intronic
1022376356 7:29815296-29815318 AGCTTTTAAAATGTGGGGAAAGG - Intronic
1023481379 7:40638531-40638553 AGGTGTTAAAAGCTTGATTAGGG + Intronic
1023776065 7:43608795-43608817 AGATATTAAAAGCTGGGGAAAGG + Intronic
1024908583 7:54419275-54419297 ACATTTTAAAAGATGGCGTAGGG - Intergenic
1026150441 7:67783791-67783813 AGCTTTTAAAATCTGAAGGCAGG + Intergenic
1027985868 7:85289004-85289026 AGCTGAGAAAAGCTGGAGGATGG - Intergenic
1028150632 7:87367337-87367359 AGCCTCTAAAAGCTGGAAAAAGG + Intronic
1028216228 7:88136953-88136975 ACTTTTTAAAAGCTGGATAATGG - Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028332819 7:89617344-89617366 AGCATTTAAAATTTGGAGAAAGG - Intergenic
1031451443 7:121925816-121925838 AGCTTTTACAACTTGGAGCAAGG + Intronic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1032601018 7:133295155-133295177 AGCTAGTAAAAGTTGAAGTAGGG + Intronic
1034424171 7:151005656-151005678 AGCATTTAAAAGTGGGAGCAAGG + Intronic
1034427292 7:151020762-151020784 AGCTTTTGGAAGCTGCAGTGAGG - Intronic
1034606728 7:152323338-152323360 AGCCTTGAAAAGCGGGAGGATGG + Intronic
1036042725 8:5103989-5104011 ACTTTTAAAAAGCTGGAGTGGGG - Intergenic
1038512818 8:28156271-28156293 TGTTTTTAAAAACTGGAGTGGGG - Intronic
1039084395 8:33765543-33765565 AGCTTTTAACAGCTGAAGCTGGG + Intergenic
1041342591 8:56861822-56861844 ATGTTTTAAAAACTGGATTATGG + Intergenic
1041621840 8:59979661-59979683 AACATACAAAAGCTGGAGTAAGG + Intergenic
1043499909 8:80842656-80842678 AGCTTTTAAAAGAGTGAGAATGG - Intronic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1045161272 8:99547882-99547904 AGGTTTTAAAGGCTGCAATAAGG + Intronic
1046582928 8:116115128-116115150 GGGTTTTAAATGCTGGAGTTTGG + Intergenic
1047631965 8:126717506-126717528 AGCTTTTAATGGTTGGAGTTTGG - Intergenic
1047660520 8:127029531-127029553 AGCTATAAAAACCTGGAGAAAGG + Intergenic
1047836354 8:128697729-128697751 AGCTTTTAAATGCTGCAGCTGGG - Intergenic
1048470607 8:134700819-134700841 AGCTTGTACAAGGTAGAGTAGGG - Intronic
1049856003 8:144862319-144862341 TGTTTTTAAGAGCTGAAGTAGGG + Intergenic
1050980005 9:11997615-11997637 AGCTTCTAAAGGCTGGGGCACGG + Intergenic
1051974563 9:22933944-22933966 AGTTTTTAAAAGTTGGGATAGGG + Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1052480604 9:29020546-29020568 AGCTTCTAAAAGCTTGGGAAAGG + Intergenic
1052486232 9:29103890-29103912 AGCTATTAAAAGTTGAAGTTGGG - Intergenic
1053228025 9:36378758-36378780 AGCTTTTAAAAGTAGAGGTAAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054885297 9:70191267-70191289 ACCTTTGAAATGGTGGAGTAAGG - Intronic
1055411930 9:76039734-76039756 AGCTTCTCAAAGCTGTAGAACGG - Intronic
1055473678 9:76639867-76639889 AGCTTTCAAAAGATGGGGAATGG - Intronic
1055796034 9:79975866-79975888 AGGTTTTACAAGCTAGAGAAGGG + Intergenic
1056945535 9:90992448-90992470 GGATTTTGAAAACTGGAGTATGG - Intergenic
1057341994 9:94211198-94211220 AGCTAGTAAGAGCTGGAGTCAGG - Intergenic
1058228374 9:102394999-102395021 AGTTTTTGAAAGCTGGAGTTGGG + Intergenic
1186362241 X:8854305-8854327 AGCTTTTAAAATCTCAAGAAAGG + Intergenic
1186724658 X:12344426-12344448 AGATTTTAAAAAGTGGAGGAGGG - Intronic
1186813617 X:13214231-13214253 AGCTAGTAAATGCTGGAGGAGGG + Intergenic
1187985389 X:24805053-24805075 AGCTTCTGAAAGCTGGAAAAGGG - Intronic
1188661735 X:32768823-32768845 ATACTTTAAAAGCTGGAGAAAGG - Intronic
1188670245 X:32873212-32873234 AGCTTTTAAAAGGAGGAGGGGGG - Intronic
1188908257 X:35813870-35813892 TGGTTTTAAATGCTGGAGAATGG - Intergenic
1189057139 X:37709958-37709980 AGCTATTAAAATCTGGACTGAGG - Intronic
1189712678 X:43829951-43829973 AGCTTTTAAAATCTGATGTGTGG - Intronic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1194313604 X:92344915-92344937 CGCTTCTAAAAGCAGGAATAGGG + Intronic
1195574708 X:106436925-106436947 AAATTTTAAAAGCTGTACTAAGG + Intergenic
1196671465 X:118372758-118372780 AGCTTTTAAATGCAGGCGCATGG + Intronic
1196766388 X:119249099-119249121 AGCATTTAAAAGCTTGAGCAGGG + Intergenic
1198127980 X:133666073-133666095 TGGTTTTGGAAGCTGGAGTACGG - Intronic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1199214603 X:145250510-145250532 TGTTTTTAAAAGCTGGAGTAGGG + Intronic
1200621875 Y:5459036-5459058 CGCTTCTAAAAGCAGGAATAGGG + Intronic
1202039399 Y:20666643-20666665 AAACTTTAAAAACTGGAGTATGG + Intergenic
1202334689 Y:23795283-23795305 AGCTTTTAAAAGATAAGGTATGG + Intergenic
1202536078 Y:25874776-25874798 AGCTTTTAAAAGATAAGGTATGG - Intergenic