ID: 1199034397

View in Genome Browser
Species Human (GRCh38)
Location X:143033243-143033265
Sequence GAGAATAAGGAGAACGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199034392_1199034397 -4 Left 1199034392 X:143033224-143033246 CCAGGACTGGAGAAAATGAGAGA 0: 1
1: 1
2: 1
3: 44
4: 311
Right 1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG 0: 1
1: 0
2: 3
3: 33
4: 328
1199034389_1199034397 9 Left 1199034389 X:143033211-143033233 CCTAGAGGTCAGCCCAGGACTGG 0: 1
1: 0
2: 0
3: 30
4: 301
Right 1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG 0: 1
1: 0
2: 3
3: 33
4: 328
1199034391_1199034397 -3 Left 1199034391 X:143033223-143033245 CCCAGGACTGGAGAAAATGAGAG 0: 1
1: 1
2: 2
3: 47
4: 357
Right 1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG 0: 1
1: 0
2: 3
3: 33
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199034397 Original CRISPR GAGAATAAGGAGAACGGGGC TGG Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902920458 1:19663595-19663617 TAGTATAAAGAGAACGGGGTGGG - Intergenic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903673825 1:25052179-25052201 GAGAGTAAGGAGAGCTGGTCTGG - Intergenic
903746949 1:25593424-25593446 GAGAATGGGGAGAACAGGGTGGG + Intergenic
903854557 1:26329027-26329049 GAGAATCAGGAGCACTCGGCTGG - Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
905486083 1:38297898-38297920 GAAAGGAAGGAGAACTGGGCTGG - Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
911092601 1:94029734-94029756 GAGAATAAGAAGAAAGGGCCTGG - Intronic
912075286 1:105866831-105866853 GAGAATAAGGAGAAAGGAATAGG + Intergenic
912922568 1:113883390-113883412 GAGAATCAGGTGAACCGGGGAGG + Intronic
913127690 1:115808204-115808226 GAGAATAAGGGGTAGGGGGTTGG - Intergenic
913401802 1:118443119-118443141 GAGATTATGGAGAATGGGGGAGG + Intergenic
913942270 1:125119624-125119646 GAGAAGAAGGAGAGCGGTGGAGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
915114617 1:153588868-153588890 GAAAATAAGCAGAACGGACCGGG + Intergenic
915156968 1:153885051-153885073 CAGAAGATGGAGAACAGGGCCGG - Intronic
918866240 1:189904104-189904126 GAAAATAATGAGAACAAGGCCGG - Intergenic
919681928 1:200444113-200444135 GAGAAAAAGTAGGAAGGGGCAGG - Intergenic
919870096 1:201813765-201813787 TAGAATAAGGAGACCGGGCGTGG + Intronic
920691975 1:208154114-208154136 GAGAACAAGGTGACCGGGGAGGG - Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923600183 1:235395839-235395861 GATAGCAAGTAGAACGGGGCTGG - Intronic
1062858183 10:789995-790017 GCGAACAAGGAGCATGGGGCTGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063102093 10:2959181-2959203 GAAAATATGGAAAACAGGGCCGG + Intergenic
1063869643 10:10403684-10403706 GAGAAGCAGCAGAACTGGGCAGG - Intergenic
1065331410 10:24604027-24604049 GAGAAGAAAGAGAACAGGGGTGG + Intronic
1065369256 10:24966521-24966543 GAGAATAATGAAAACGGTGTTGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1070495307 10:77015930-77015952 GAGAATGAGAGGAATGGGGCAGG - Intronic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1074098754 10:110336497-110336519 GAAAAAAAGAAGAAAGGGGCAGG - Intergenic
1074909665 10:117896415-117896437 GAAAATAATGAGAAGGGGACAGG + Intergenic
1075148042 10:119899992-119900014 GAGAAGCAGGAGGAAGGGGCAGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076241768 10:128914033-128914055 GAGTAGAGGGAGAACGGGGCAGG + Intergenic
1076475458 10:130748666-130748688 TATAAACAGGAGAACGGGGCAGG + Intergenic
1076980576 11:202465-202487 GAGAACAGGGAGAACGGTGATGG - Intronic
1077721753 11:4637210-4637232 GAGAAGAGGAATAACGGGGCTGG - Intergenic
1077778648 11:5300341-5300363 GGGAAGAAGGAAAACGGGGCTGG + Intronic
1077881580 11:6354728-6354750 GAGCATAACAAGAACTGGGCAGG + Intergenic
1079789690 11:24720972-24720994 GAAAATAAAGAGAACAGGTCTGG - Intronic
1080134867 11:28842900-28842922 GTAAATAAGGAGACCAGGGCAGG - Intergenic
1081778759 11:45695307-45695329 GAGAAAAAGGAAAAAGGGGTCGG + Intergenic
1082661232 11:55913781-55913803 GAGAATAGGAAGAACTTGGCCGG + Exonic
1083480481 11:62941976-62941998 GATAGTAAGGAAAATGGGGCCGG - Intronic
1083893079 11:65606639-65606661 GAGAATAAGGAGCTGGGGGGCGG + Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1087204244 11:95377399-95377421 GAGAAGGAGTAGAAAGGGGCAGG - Intergenic
1088444486 11:109910124-109910146 GAGAATATGGAGAAAGGTGAGGG - Intergenic
1088572067 11:111231880-111231902 TAGAAAAGAGAGAACGGGGCAGG - Intergenic
1088591957 11:111411226-111411248 GAGTAGAAGGAGAAAGGAGCAGG - Intronic
1089528310 11:119110978-119111000 GAGAAGAGGCAGAACGGGGAGGG + Intronic
1091205386 11:133817585-133817607 GGGAGTAAGGAGAACAGGGGTGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092984897 12:13836154-13836176 GAGGATGAGGAGTACTGGGCTGG - Intronic
1092991440 12:13905850-13905872 GAGGCTGAGCAGAACGGGGCTGG - Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1096751317 12:53760729-53760751 GAAAATACGGGGATCGGGGCCGG - Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1099225306 12:79962108-79962130 GGTAAAAGGGAGAACGGGGCTGG + Intergenic
1099436978 12:82657290-82657312 CAGAATAAGGAGGACAGGGCTGG - Intergenic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102230386 12:111257689-111257711 GAGAATGAGGAGGAAGGGGAAGG - Intronic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103200131 12:119081492-119081514 GAGAACAAGGGGAAAGGAGCAGG + Intronic
1103736241 12:123062482-123062504 GACAATAAGGGGGACGGGGCAGG + Intronic
1104231445 12:126888516-126888538 GAGAATAGGAAGAACTGAGCAGG - Intergenic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1108304029 13:49113061-49113083 GAGAAATAGGAGAAAGGGGGAGG - Intronic
1108674502 13:52724499-52724521 GAGAATAGGGTGAACCGGGGAGG + Intronic
1109748578 13:66659714-66659736 GAGAATTAAGAGATCGGGGAAGG - Intronic
1110253868 13:73410083-73410105 GAGGGTAAGGTGGACGGGGCTGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115738457 14:36361252-36361274 GAGAGTAAAGAGAGCAGGGCAGG - Intergenic
1117186520 14:53245714-53245736 GGGAATAAGGAAAACAGGGAAGG - Intergenic
1117587149 14:57221069-57221091 GATAATAAGGATAACTGGGCTGG + Intronic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1118995350 14:70830577-70830599 GAGAAAAAGGCGAACAGGGACGG + Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119862379 14:77945760-77945782 GAGATTAAGAAGAACAGAGCGGG - Intergenic
1120945900 14:89996747-89996769 GGGAGTAAGAAGAAAGGGGCAGG + Intronic
1122006211 14:98705950-98705972 GAGAATAAGCAGAAATGGCCGGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124216678 15:27813110-27813132 AGGAACAAGGAGAAAGGGGCAGG + Intronic
1124872126 15:33553589-33553611 TAGAATAAGGAGCAAGGAGCAGG + Intronic
1125451637 15:39814191-39814213 GAGAATGAAGAGAAAGAGGCAGG - Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127539924 15:59927160-59927182 GGGAATAGGGAGAAAGGGGAGGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129624151 15:77179292-77179314 GAGAAGAAGTAGAGCGTGGCGGG + Exonic
1129897822 15:79121752-79121774 GAGACTAAGGGGAAGGGGCCTGG - Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1131410037 15:92199989-92200011 GAGAATGAGGGGAAAGGGGAGGG + Intergenic
1132841297 16:1979596-1979618 GAGAATGTGGAGAAGGGTGCGGG - Exonic
1135505037 16:23029020-23029042 GAGAAGAAGGAGACCTGGGCAGG - Intergenic
1136248248 16:28987204-28987226 GAAAATCAGAAGAACAGGGCCGG - Intronic
1136536547 16:30902989-30903011 AAGAGTTAAGAGAACGGGGCAGG - Exonic
1136633926 16:31507483-31507505 GAGAATAGGGATAAAGGGGAGGG + Intronic
1136696269 16:32084459-32084481 GAGAAGAAGGAGAGCGGTGGAGG - Intergenic
1136699270 16:32116735-32116757 GAGAATAAGGAGGGCGGTGGCGG + Intergenic
1136796764 16:33027711-33027733 GAGAAGAAGGAGAGCGGTGGAGG - Intergenic
1136799761 16:33059906-33059928 GAGAATAAGGAGGGCGGTGGCGG + Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138575908 16:57907211-57907233 GAGAGTAAGCAGAGCAGGGCAGG - Intronic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1139686158 16:68605284-68605306 GAGAAGAAGGAAAACAGGCCAGG - Intergenic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144404513 17:14939840-14939862 GGCAATAAGCAGAAGGGGGCTGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144689865 17:17254008-17254030 AATAATAAGGAGTACAGGGCTGG + Intronic
1145935545 17:28712523-28712545 GACAATCTGGAGAACAGGGCAGG + Intergenic
1145991092 17:29079928-29079950 GAGAAGAAAGAGAACGGAGACGG - Intronic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146458570 17:33025796-33025818 GAGGATGAGAAGAAAGGGGCTGG - Intronic
1146796862 17:35787783-35787805 AAGACTAAGGACAAAGGGGCTGG - Intronic
1147480001 17:40751470-40751492 GAGAATTAGGTCAACGGGACAGG - Intronic
1147681597 17:42251243-42251265 GAGAATAACGAGAACTGTCCTGG + Intronic
1148130130 17:45257335-45257357 GGGAACAAGGAGAGCGGGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148907515 17:50920646-50920668 GCAAATAAGCAGAAGGGGGCTGG - Intergenic
1151321089 17:73352696-73352718 GAGCATAGTCAGAACGGGGCTGG - Intronic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152547954 17:81012232-81012254 GAGAAAAAGGAAAAAGGGGTGGG + Intergenic
1155043668 18:22085671-22085693 GAGAGTAAGGAAGACGGAGCTGG - Intergenic
1157470405 18:47983925-47983947 GAGAAAAAGGAGAGAGGGGGAGG - Intergenic
1158643234 18:59220546-59220568 GAGTTTTAGGAGAACGGGGAAGG - Intronic
1158721782 18:59931625-59931647 GAGAATAAGAAGCTAGGGGCCGG - Intergenic
1159030197 18:63223103-63223125 TAAAATAAGAAGAACAGGGCAGG + Intronic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1162977212 19:14213619-14213641 GAGAATAGTGTGAACGGGGGAGG + Intergenic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1166124308 19:40704597-40704619 GCGAATAAGCAGAACAGGGATGG + Intronic
1167682590 19:50933438-50933460 GAGAAAATGAAGAAAGGGGCCGG - Intergenic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1167752132 19:51387653-51387675 GACAACAGGGAGAGCGGGGCTGG + Intronic
1167783381 19:51615535-51615557 GAGGAGAAGGAGAACGGAGGTGG + Intronic
1168064243 19:53910042-53910064 AGGAATAAGGAGATCTGGGCGGG + Intronic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925188027 2:1862891-1862913 GAGAAGAAGGAGAAAGGAGGAGG + Intronic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926644957 2:15280410-15280432 GAGAATAAAGAGGATGGGGAAGG + Intronic
927070766 2:19526975-19526997 TAGAATAGGGAGAATGGGCCAGG + Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
930547024 2:52781216-52781238 GAGAAAATAGAGAAAGGGGCAGG - Intergenic
931366019 2:61619711-61619733 GACAAGAAGCATAACGGGGCAGG + Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932009396 2:67960223-67960245 GAGAACATGGAAAACAGGGCTGG - Intergenic
932757816 2:74421076-74421098 TAAAATAAAGAAAACGGGGCCGG - Intronic
933091222 2:78119851-78119873 GAGAATAAGGAGGAAGGAGAGGG + Intergenic
934042891 2:88144606-88144628 CAGAATAAGAAGACCTGGGCAGG + Intergenic
935882581 2:107580431-107580453 GAGCATAGGAAGAAAGGGGCAGG + Intergenic
936922927 2:117707547-117707569 GAGAATCAGGAGAACCCGGGAGG + Intergenic
937048053 2:118863291-118863313 GGGAGTAAGGAGAGTGGGGCTGG + Intergenic
938518202 2:132037947-132037969 GAGAAGAAGGAGGGCGGGGGCGG - Intergenic
939166438 2:138645950-138645972 GAGAAAAGGGAGACTGGGGCTGG + Intergenic
939987010 2:148839421-148839443 GAGAAGAAAGAGAAAGGAGCAGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
941751325 2:169137847-169137869 AAGAATAAGGAGAGAGGGGAAGG + Intronic
941870213 2:170376575-170376597 GGGAATAAGGAAAAAGGTGCAGG - Intronic
942104973 2:172624695-172624717 GAGAATAAGAAGGAAGGGGCAGG + Intergenic
945012887 2:205483590-205483612 GAGAAAAAGGAGAGAGGGGAGGG - Intronic
946094180 2:217258257-217258279 TAGAATAAAGATAAAGGGGCTGG + Intergenic
946217075 2:218192638-218192660 GAGAATAAAGGGAAAGGGGGAGG + Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948649090 2:239427795-239427817 GAGCAAAAGGAAAACAGGGCAGG - Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1171958771 20:31478486-31478508 GAGAAAAAGGAAATCAGGGCAGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173575694 20:44111896-44111918 GAGCATGAGGGGAATGGGGCGGG - Exonic
1174039750 20:47690532-47690554 GTGGATAGGGAGAACAGGGCAGG + Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1175088376 20:56480740-56480762 GAGAATAGGGAGAACTGAGAAGG + Intronic
1175990418 20:62785826-62785848 GAGAATTAAGGGAACGCGGCGGG + Intergenic
1176272716 20:64244799-64244821 GGGAATGAGAAGAAAGGGGCTGG - Intergenic
1179104038 21:38382656-38382678 GAGAAGGAGGAGACCAGGGCTGG - Exonic
1179745913 21:43444194-43444216 CAGCATATGGAGAACGCGGCAGG + Intergenic
1180939289 22:19646481-19646503 GAGAATGATGAGAACAGTGCAGG - Intergenic
1181817287 22:25448110-25448132 GAGAAGAAGGAAAGCGGGGCCGG + Intergenic
1183073319 22:35411351-35411373 GAGAAGGAGGAGGTCGGGGCTGG + Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1184481985 22:44753117-44753139 GAGAAAACGGAGGCCGGGGCAGG + Intronic
1185379708 22:50502807-50502829 GAGAATGCTGAGGACGGGGCAGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952704165 3:36360567-36360589 GAAAAGAATGAGATCGGGGCCGG + Intergenic
954006294 3:47593866-47593888 GAGAATTAGGAATAAGGGGCTGG + Intronic
956726510 3:72160947-72160969 GAGAATAAGCAGATCGTGGAAGG + Intergenic
956748551 3:72328797-72328819 GGGAAAAAGAAGAAAGGGGCGGG + Intergenic
957825038 3:85430592-85430614 GCGAATAAGGAGAAAGGGGGCGG + Intronic
958648015 3:96898429-96898451 TGGAATAAGGAAATCGGGGCAGG - Intronic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
961007737 3:123416126-123416148 GAGAATCAGCAGAAAGGGACAGG + Intronic
961266518 3:125647506-125647528 GAAAACAAGGAGCACGAGGCTGG + Intergenic
962500013 3:135981763-135981785 GAGAGTAATGAGAAGGGGCCAGG + Intronic
963711743 3:148754791-148754813 GAGAATAAAGGAAACGGGACTGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
966030314 3:175338425-175338447 GAGAATAAGGAGATAGGAGTTGG + Intronic
968600511 4:1506523-1506545 GAGAAAAAGACGAACGGGGGCGG - Intergenic
969383986 4:6830700-6830722 GAGAATAAAGAAAACAGGCCGGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970936619 4:21578495-21578517 GAGAAAAAGAAAAACGGAGCAGG + Intronic
971410813 4:26369866-26369888 GAGAAGAGAGAGAAAGGGGCTGG - Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976402511 4:84623432-84623454 GAAACTAAGGAGAAAGGGCCCGG - Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
978602624 4:110444579-110444601 GGCAATAAAGAGAATGGGGCTGG - Intronic
979427105 4:120581392-120581414 GAGAATAATGACCAAGGGGCAGG - Intergenic
979996919 4:127442427-127442449 AAGAATAGGGAGAACCGGGCAGG + Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
981083082 4:140654455-140654477 GAGAAAAAGAAGAAAGGGGTGGG + Intronic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
983010329 4:162538239-162538261 GAGAATACGGGGTTCGGGGCTGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985490797 5:177754-177776 GAGAATCATGGGAAAGGGGCTGG - Intronic
988482685 5:31642789-31642811 GAGAATGAGGAAAACAGGGGAGG + Intronic
988880996 5:35502405-35502427 GAGAATAAGGAGGACGCAGTTGG + Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
991080130 5:62589554-62589576 GGGAATAAAGAGAAAGGGGTAGG - Intronic
991430614 5:66541061-66541083 GAGATTTAGCAGAACGAGGCTGG - Intergenic
991612722 5:68465632-68465654 GAGAATAAGGAGAAAAGGAAAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992376783 5:76196034-76196056 GAAAATGAGGGAAACGGGGCTGG + Intronic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
993424617 5:87747939-87747961 GAGGCTTAGGAGTACGGGGCTGG + Intergenic
994082039 5:95717715-95717737 GAGAAGAGGAAGAACGGGCCTGG + Intronic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994397799 5:99240504-99240526 GAGAATAAAGAGAACATGGATGG + Intergenic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
996235154 5:121118958-121118980 GAGAAAAAGGAGAACAGTACAGG + Intergenic
997715689 5:136040944-136040966 GAGTATAAGGAGAGTGGAGCAGG + Intronic
998857572 5:146408322-146408344 GAGAATAAGAGGAGTGGGGCTGG - Intergenic
999435441 5:151559783-151559805 GAGAATAGGGGCAACTGGGCAGG - Intronic
1002605514 5:180380688-180380710 GAGAATGAGCAGGAAGGGGCCGG - Intergenic
1005913095 6:30327394-30327416 AAGAAGATGGAGAACGGGGGTGG + Intronic
1007355496 6:41312531-41312553 GAAAATAAAGAGAACAGGCCAGG + Intergenic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008527583 6:52421293-52421315 TAGAATAAAAAGAACAGGGCCGG - Intronic
1010976974 6:82326141-82326163 GAGAACAAAGAGAACAGGGTGGG - Intergenic
1011134255 6:84082806-84082828 GACAAAAAGGAGAAAGGGGTGGG - Intronic
1014745065 6:125191207-125191229 GAGAATAAAGAAAGCGTGGCTGG - Intronic
1016116090 6:140287927-140287949 GGGAATAAGGAGAACGGTTGTGG + Intergenic
1017504039 6:155051211-155051233 GAGAATAAGAAGAATGGAGATGG + Intronic
1017790127 6:157790556-157790578 GAGAATACAGAAAACAGGGCTGG - Intronic
1018421265 6:163642696-163642718 GAGAGCAAGGAAAACGGGGAGGG + Intergenic
1018563871 6:165130850-165130872 GAGATTCAGGAGAACAGGGGCGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019980740 7:4620117-4620139 GAGAATCTGGAGAACCAGGCTGG + Intergenic
1020909457 7:14110346-14110368 GAGAATAAGCAGAAAGGAGTAGG - Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1022785302 7:33632105-33632127 TGGCATAAGGAGAACGGGGTAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024663903 7:51526857-51526879 GAGGATATGGAGAAAGGGGAAGG + Intergenic
1024755458 7:52525032-52525054 GAGATTCAGGGGAAGGGGGCCGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025320383 7:58088086-58088108 GAGAAGAAGGAGAGCGGTGGAGG + Intergenic
1025622536 7:63187051-63187073 GGCAATAAAGAGAATGGGGCTGG - Intergenic
1025957225 7:66192329-66192351 TAGAATAAAGTGAACTGGGCCGG + Intergenic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028746829 7:94336895-94336917 GAGAACAAGGAGAATGTAGCAGG - Intergenic
1029549672 7:101231046-101231068 GAGATGAAGGAGAAAGGGGAGGG + Intergenic
1030009878 7:105155276-105155298 GAGATTAAGAATAAGGGGGCTGG - Intronic
1031084210 7:117286422-117286444 GAGAATAGGGAGAGAAGGGCGGG - Intronic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1034103592 7:148471941-148471963 GAGAAAAAGGAGGAAGGTGCTGG + Intergenic
1034445090 7:151109996-151110018 GAGGTTAAGGAGACCGTGGCTGG + Intronic
1034687933 7:152989984-152990006 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1035204655 7:157287378-157287400 GACAAAAAGGAGAACTGGCCGGG - Intergenic
1036783113 8:11663825-11663847 AAGAATAAGAAAAACTGGGCTGG + Intergenic
1037225486 8:16584628-16584650 GAAAATAAGGAGAAACGGCCAGG + Intergenic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1037951017 8:23018863-23018885 GAGAAGAGGGAGAATGGAGCAGG + Intronic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1041690249 8:60679963-60679985 GAGAAGAAAGGGAGCGGGGCCGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043472812 8:80578676-80578698 GAGGAGAAGGAGAACAGGGGAGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1045745013 8:105408171-105408193 GAGAATTAGGAGAGCGGGTAGGG - Intronic
1045930837 8:107624611-107624633 TAGAAAAATGATAACGGGGCTGG - Intergenic
1046348036 8:112962793-112962815 GAGAATAGGGAGAATGGACCTGG - Intronic
1047742022 8:127814212-127814234 GGGAATAATGAGGAAGGGGCTGG - Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049447860 8:142639690-142639712 GAGAAAAGGGAGGACAGGGCGGG + Intergenic
1049780688 8:144427457-144427479 GACACTCAGGAGAGCGGGGCGGG + Intronic
1050481089 9:6087417-6087439 GAGAAAAAGGAAAAAGGGGTGGG - Intergenic
1050992948 9:12174980-12175002 GAGGAAAAGGAGAAAGGAGCAGG + Intergenic
1051562891 9:18462640-18462662 TAGAAGAAGGAAAAAGGGGCCGG + Intergenic
1051626253 9:19102505-19102527 GAGTGTAAGGAGGCCGGGGCCGG - Exonic
1052081933 9:24216894-24216916 GTGAGTAAGGAGAATGGGTCAGG + Intergenic
1052474677 9:28943722-28943744 GAAAAAAAGGATAACAGGGCTGG + Intergenic
1053495366 9:38545062-38545084 GAGAAGAGGGAGTACAGGGCTGG + Intronic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057859964 9:98633325-98633347 AAGAATAAGAAGAACAGGCCAGG + Intronic
1060779866 9:126403432-126403454 GAGAAGAAGGAAAACGACGCAGG - Intronic
1062087584 9:134656895-134656917 GATAATATGGGGGACGGGGCAGG + Intronic
1062087605 9:134656970-134656992 GATAATATGGGGGACGGGGCAGG + Intronic
1062097897 9:134712219-134712241 GGGGATAAGAAGAAGGGGGCAGG - Intronic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185725775 X:2420446-2420468 TAAAATAAAGAGAATGGGGCCGG + Intronic
1187412393 X:19062577-19062599 GAGAATGAGGAGACCAGGACAGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1189345155 X:40235251-40235273 GAGAATAAGTATAAGAGGGCTGG - Intergenic
1189551621 X:42099417-42099439 GAGAAGAAGGAGAAAGGAGGAGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189857548 X:45238455-45238477 GAGAGGAAACAGAACGGGGCAGG + Intergenic
1190879728 X:54483723-54483745 GAGGAGAAGCAGACCGGGGCTGG - Intronic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1195085206 X:101407389-101407411 GTGAAAAAAGAGAACCGGGCAGG + Intronic
1195702881 X:107717848-107717870 GAGACTAAAGAGAAAAGGGCTGG - Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1201011397 Y:9550458-9550480 GAGAATACTGGGAATGGGGCAGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1202168873 Y:22020040-22020062 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202222488 Y:22566328-22566350 GGGAATCAGGAGAATGGGCCTGG + Intergenic
1202320627 Y:23629332-23629354 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202550140 Y:26040724-26040746 GGGAATCAGGAGAATGGGCCTGG + Intergenic