ID: 1199038899

View in Genome Browser
Species Human (GRCh38)
Location X:143086675-143086697
Sequence TTCAGGTTAGCTAGTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199038896_1199038899 -8 Left 1199038896 X:143086660-143086682 CCGACAGCAAATACCTTCAGGTT No data
Right 1199038899 X:143086675-143086697 TTCAGGTTAGCTAGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199038899 Original CRISPR TTCAGGTTAGCTAGTAGAGG AGG Intergenic
No off target data available for this crispr