ID: 1199045569

View in Genome Browser
Species Human (GRCh38)
Location X:143167319-143167341
Sequence CTGAAGAAGCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199045565_1199045569 2 Left 1199045565 X:143167294-143167316 CCTGTGTGGTGTCTTCTGAGTGA No data
Right 1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199045569 Original CRISPR CTGAAGAAGCAGAAGGAGGG TGG Intergenic
No off target data available for this crispr