ID: 1199054343

View in Genome Browser
Species Human (GRCh38)
Location X:143274970-143274992
Sequence AGACCTCTGTTTCCAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199054343_1199054344 -5 Left 1199054343 X:143274970-143274992 CCAGCAGTTGGAAACAGAGGTCT No data
Right 1199054344 X:143274988-143275010 GGTCTAGACAAACACAGTCATGG No data
1199054343_1199054347 26 Left 1199054343 X:143274970-143274992 CCAGCAGTTGGAAACAGAGGTCT No data
Right 1199054347 X:143275019-143275041 GAGGATAGACGTCTAAATTCAGG No data
1199054343_1199054346 7 Left 1199054343 X:143274970-143274992 CCAGCAGTTGGAAACAGAGGTCT No data
Right 1199054346 X:143275000-143275022 CACAGTCATGGGTATCTAAGAGG No data
1199054343_1199054345 -4 Left 1199054343 X:143274970-143274992 CCAGCAGTTGGAAACAGAGGTCT No data
Right 1199054345 X:143274989-143275011 GTCTAGACAAACACAGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199054343 Original CRISPR AGACCTCTGTTTCCAACTGC TGG (reversed) Intergenic
No off target data available for this crispr