ID: 1199056310

View in Genome Browser
Species Human (GRCh38)
Location X:143299180-143299202
Sequence TCTTTTCTTTGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199056310_1199056319 -7 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056319 X:143299196-143299218 GAAAAGATAAAATTGGGGGGAGG No data
1199056310_1199056321 -5 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056321 X:143299198-143299220 AAAGATAAAATTGGGGGGAGGGG No data
1199056310_1199056323 2 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056323 X:143299205-143299227 AAATTGGGGGGAGGGGGAATTGG No data
1199056310_1199056318 -10 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056318 X:143299193-143299215 AAAGAAAAGATAAAATTGGGGGG No data
1199056310_1199056322 -4 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056322 X:143299199-143299221 AAGATAAAATTGGGGGGAGGGGG No data
1199056310_1199056320 -6 Left 1199056310 X:143299180-143299202 CCTTCCACCTTCCAAAGAAAAGA No data
Right 1199056320 X:143299197-143299219 AAAAGATAAAATTGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199056310 Original CRISPR TCTTTTCTTTGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr