ID: 1199065896

View in Genome Browser
Species Human (GRCh38)
Location X:143417921-143417943
Sequence GTGCTATGCTGGGCTAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199065896_1199065903 22 Left 1199065896 X:143417921-143417943 CCCCATTTAGCCCAGCATAGCAC No data
Right 1199065903 X:143417966-143417988 TTCCCACCAGCAGAAAGTTCTGG No data
1199065896_1199065904 23 Left 1199065896 X:143417921-143417943 CCCCATTTAGCCCAGCATAGCAC No data
Right 1199065904 X:143417967-143417989 TCCCACCAGCAGAAAGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199065896 Original CRISPR GTGCTATGCTGGGCTAAATG GGG (reversed) Intergenic
No off target data available for this crispr