ID: 1199074726

View in Genome Browser
Species Human (GRCh38)
Location X:143514374-143514396
Sequence ATTTTCTAAAAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199074726_1199074729 -1 Left 1199074726 X:143514374-143514396 CCCTACTCCAGCTTTTAGAAAAT 0: 1
1: 0
2: 1
3: 31
4: 319
Right 1199074729 X:143514396-143514418 TTATATACATTCTTCTGCCATGG 0: 1
1: 0
2: 1
3: 33
4: 397
1199074726_1199074732 26 Left 1199074726 X:143514374-143514396 CCCTACTCCAGCTTTTAGAAAAT 0: 1
1: 0
2: 1
3: 31
4: 319
Right 1199074732 X:143514423-143514445 CAATCTGAAATATATTACTAAGG 0: 1
1: 0
2: 6
3: 17
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199074726 Original CRISPR ATTTTCTAAAAGCTGGAGTA GGG (reversed) Intronic
900816828 1:4853935-4853957 ATTTTCAAAATGTTGGAGTGAGG - Intergenic
901188053 1:7387605-7387627 CTTTTCTTAAAGCTGGAGGCAGG + Intronic
905325640 1:37149910-37149932 ATTTTTTAAAAGCAGGACTGAGG - Intergenic
905457943 1:38101128-38101150 ATTTCCTAAATGCTGGCCTAAGG - Intergenic
905929082 1:41773806-41773828 ACTGACTAAAAGCTGGAGAATGG - Intronic
907646421 1:56248718-56248740 AATTTCTAAAAGCAAGAGTAAGG + Intergenic
907677970 1:56536343-56536365 AGTTTCTTAAAGGTGGACTAAGG - Intronic
910477045 1:87618634-87618656 ATTTTTTTAAAGGTGGAGTTAGG + Intergenic
911944999 1:104095921-104095943 ATTTGCTACAGGCTGGAGGAAGG + Intergenic
913682102 1:121195825-121195847 GTTTTCCTAAAGTTGGAGTAAGG - Intronic
914033938 1:143983445-143983467 TTTTTCCTAAAGTTGGAGTAAGG - Intergenic
914155509 1:145084527-145084549 TTTTTCCTAAAGTTGGAGTAAGG + Intronic
914790718 1:150875715-150875737 TTTGTCTAAGAGATGGAGTAGGG - Intronic
915652550 1:157326927-157326949 ATTTTGTTATAGCTGGAATATGG + Intergenic
916630001 1:166602013-166602035 ATTTTCTAAAAGCAGTATCACGG - Intergenic
916851173 1:168705534-168705556 TTTTTTAAAAAGCTGAAGTATGG - Intronic
917165122 1:172103340-172103362 AATGTCTAAAAGCTGGTGTATGG + Intronic
918573521 1:186027116-186027138 TGTTTCTCAAAGCTGTAGTAAGG + Intronic
918724760 1:187906028-187906050 GTTTTATAAAAGCTTGATTATGG - Intergenic
918739470 1:188108790-188108812 AGTTTCCAAAGGCTGGAATAAGG - Intergenic
918882008 1:190136948-190136970 CTTATTTAAAAGCTGGGGTATGG + Intronic
919087437 1:192937314-192937336 GTCTTCTAAGAGCTGGTGTAGGG + Intergenic
919401234 1:197120021-197120043 ATTGTATAAAAGAGGGAGTATGG + Intronic
920469415 1:206214334-206214356 TTTTTCCTAAAGTTGGAGTAAGG - Intronic
921594882 1:217043960-217043982 CTTTTCTAAAAATTGGAGAAAGG - Intronic
922063223 1:222111364-222111386 ATTGTCTAAAAGCAGCAATAAGG - Intergenic
922314472 1:224430749-224430771 TTTTTCTAAATGCTGGAGTTTGG - Intronic
923380648 1:233414490-233414512 ATTTCCTAAATGCTGGATTTTGG + Intergenic
923710193 1:236382317-236382339 AATTTCTAAAAGTTGTAGTTTGG + Intronic
1062875911 10:942904-942926 ATCATCTGAAAGCTGGAGTGAGG - Intergenic
1063647499 10:7899521-7899543 ATGTTCTAGAAGATGGAGAAGGG - Intronic
1064300729 10:14120450-14120472 ATTTGCTAACAGCTGCTGTATGG - Intronic
1065045264 10:21742193-21742215 ATGTTCAAAAAACTGGGGTAAGG - Exonic
1065771866 10:29085422-29085444 ATCTTTCATAAGCTGGAGTATGG - Intergenic
1067010662 10:42709879-42709901 ATAATCGAATAGCTGGAGTAAGG - Intergenic
1067312846 10:45131319-45131341 ATAATCGAATAGCTGGAGTAAGG + Intergenic
1069176424 10:65294614-65294636 AATTTCTAAGAACTGGAGTTAGG - Intergenic
1071931073 10:90470954-90470976 ATTTTTTAAAAGCAGGAATGAGG + Intergenic
1072808512 10:98442473-98442495 ATTTTTTAATAGCTGTATTAAGG - Intronic
1072848086 10:98855189-98855211 ATATTGCAAAAGGTGGAGTATGG + Intronic
1073191807 10:101656656-101656678 TTGTTCTAAAAGCTGGATTATGG + Intronic
1073798043 10:107010224-107010246 ACTTTCTAAAGGATGGAGTAGGG + Intronic
1073824924 10:107309568-107309590 ATTTTCTTATAGCTGCAGAATGG + Intergenic
1073939237 10:108675290-108675312 ACTTTCAAAATGCTGGAGAAAGG + Intergenic
1074382121 10:112989893-112989915 ATTTTCTAATAGATGGGGTGAGG + Intronic
1075204301 10:120433577-120433599 ATTTTATAGAAACTGGAATACGG + Intergenic
1077872910 11:6278595-6278617 ATTTTTTAAGTGGTGGAGTAAGG + Intergenic
1078899316 11:15626894-15626916 TTTTTCTAAAAACTGAACTAAGG + Intergenic
1078937844 11:15967581-15967603 ATTTGCTACAAGCTGGAGGAGGG + Exonic
1080048193 11:27831549-27831571 CTTTTCTAAAAGCTGTTTTATGG + Intergenic
1081824300 11:46033163-46033185 ATTTTTTAAAAACTATAGTATGG + Intronic
1083044549 11:59722052-59722074 ACATTCTAAAATCTGGAGTCTGG + Intronic
1085293499 11:75417290-75417312 ATTTTTTAAGAGATGGAGTCTGG - Intronic
1086017888 11:82189345-82189367 ATTTTTTAAAAACTGGAATTTGG - Intergenic
1087524185 11:99286926-99286948 GTTTTCTAAAACCTGTACTAAGG + Intronic
1087709452 11:101532353-101532375 ATTTCCTCAAAGGTGGAGTGAGG - Intronic
1088047905 11:105475736-105475758 ATTTTTTAAAATCTGTAATAGGG + Intergenic
1088588906 11:111384766-111384788 ATTTTCTTAAAGCTGGGAAAAGG + Intronic
1088998725 11:115030186-115030208 ATTTTTTAAAAGGTGGAGGATGG + Intergenic
1090051047 11:123380011-123380033 ATTTTTTTAAAGCTGGAGAAAGG - Intergenic
1090962678 11:131571215-131571237 TTTTTATAAATGCTGGAGTTGGG + Intronic
1090994407 11:131852458-131852480 ATCTTCTAAAACCTAGAGAAAGG - Intronic
1092013466 12:5136796-5136818 ATTTTCTAATTGCAGGACTATGG + Intergenic
1092085395 12:5753950-5753972 TTTTTCTAAGATCTGGAATAAGG - Intronic
1092228340 12:6763562-6763584 ATTTTCTGAAAGCGGGAAAAAGG - Intronic
1092917242 12:13200076-13200098 ATTTTCTAAATGCATGAATATGG + Intronic
1093789766 12:23235051-23235073 ATTTTATAAAATCATGAGTATGG - Intergenic
1093943562 12:25082296-25082318 ATTTTTTAAAAACTAAAGTAAGG + Intronic
1097375086 12:58833519-58833541 ATTTTCTTGAAGATGGAGAATGG - Intergenic
1098156978 12:67609263-67609285 ATTTACTAAGAGCTTGAGTGGGG + Intergenic
1098818555 12:75200644-75200666 ATTTTCTAAAAACAGAAATATGG + Intronic
1099062612 12:77930975-77930997 ATATTCTAAAAGCTTCAGGAGGG - Intronic
1099236475 12:80088346-80088368 ATTTGCTAAAAGATCTAGTAAGG - Intergenic
1099470278 12:83039929-83039951 ATTTTCATAACTCTGGAGTAAGG - Intronic
1099583185 12:84479977-84479999 ATTTTCAAAAAGCTGGAAGAGGG + Intergenic
1100032826 12:90214091-90214113 ACTTGATAAAAGCAGGAGTAGGG - Intergenic
1100491694 12:95086229-95086251 CTTTTCTAAAAGCTGGATTTGGG + Intronic
1101402397 12:104399971-104399993 ATTGGCTAGAAGTTGGAGTAAGG + Intergenic
1101598943 12:106191639-106191661 ATTCTCTCAAAGCTGGACTGAGG - Intergenic
1101767942 12:107720481-107720503 ATTTTTTAAATGCTGGGGTGGGG - Intergenic
1102553028 12:113705930-113705952 ATTTAATAAAAGCTGGAGTGAGG + Intergenic
1103828319 12:123758427-123758449 ATTTTCCAACAGCTGAAGTAGGG + Exonic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108111687 13:47080691-47080713 AGTTTCTAAAAGCTGAAGGCAGG + Intergenic
1108682883 13:52794431-52794453 AGTGTCTGAAAGCTGGAGAAGGG - Intergenic
1110116738 13:71826881-71826903 ATTTACTATTAGCTGGAATAGGG + Intronic
1110371324 13:74743662-74743684 ATTTTCAACAGGCTGGAGTCTGG - Intergenic
1111147247 13:84199275-84199297 ATTATTTAAAAGGTGGAGTCTGG + Intergenic
1111423181 13:88044744-88044766 ATTTTCTCAATTCTAGAGTAAGG - Intergenic
1111488119 13:88931315-88931337 AGCTTCTAAAAGCAGGAGTCAGG - Intergenic
1112791798 13:103010936-103010958 ATTTTGTAAAAAATGGAGTCTGG + Intergenic
1112954317 13:105040291-105040313 ATTTTCTCAAACCTGAAGTGAGG + Intergenic
1113286346 13:108852990-108853012 ATTTTCTAACATTTGAAGTAGGG + Intronic
1113562237 13:111291120-111291142 ATTTGATAGAAGCAGGAGTAGGG + Intronic
1114509862 14:23249506-23249528 TTTTTACACAAGCTGGAGTATGG - Intronic
1114836480 14:26208820-26208842 ATTTCCTAAAATCTGGACTTTGG - Intergenic
1115871415 14:37807836-37807858 ATTTTCCAAAATTTGGACTATGG + Intronic
1116476490 14:45346642-45346664 ATTATCTGAAAGCTTGATTAGGG + Intergenic
1116647009 14:47541045-47541067 ATTTTTTGAAATCTGAAGTAAGG - Intronic
1116793503 14:49365005-49365027 ATTTTCTGAAAAATGGAGAATGG - Intergenic
1117457035 14:55908253-55908275 ATTTTCTTATAGCTGGGGTTTGG + Intergenic
1117848615 14:59941821-59941843 ATTTTCAAAAATCTGGAAGAAGG - Intronic
1119581191 14:75782910-75782932 CCTTTCTAAAAGCTGGAGTTGGG - Intronic
1119952198 14:78756633-78756655 AATTTTTAAAAGTTGGAGCAAGG - Intronic
1120831686 14:89003119-89003141 ATTTTCTCATAGCTGGACTGAGG + Intergenic
1120927093 14:89808841-89808863 ATTTTCTAAATGCTTGTATATGG - Intronic
1121088813 14:91167262-91167284 ATCTTTCAAAAGCTGGAGCAAGG - Exonic
1125091585 15:35799255-35799277 ATTTACTCAGAACTGGAGTATGG + Intergenic
1125295205 15:38195335-38195357 AGTTTCTAAATGCTGGACTGTGG + Intergenic
1125959701 15:43819311-43819333 ATTTTTTAAAAGGTAGAGAAAGG + Intronic
1126510328 15:49464147-49464169 ATTTTCTAAACGAGGGTGTAGGG + Intronic
1127065344 15:55231584-55231606 GTCTTCTAAAAGCTTGAGTGAGG - Intronic
1127765355 15:62180770-62180792 AGTTTCTAATAGCTAGAGGAAGG + Intergenic
1128585055 15:68841411-68841433 ATTTTAAAAAAGCTTGAATAGGG + Intronic
1129910056 15:79219638-79219660 GTTTTCTAAAACCTGGAGGCAGG - Intergenic
1130037755 15:80377130-80377152 ATATTCACAAAGCTGGAGGAGGG - Exonic
1131602614 15:93864825-93864847 AATTTCTGAAAGGTGGAGTGAGG - Intergenic
1133667405 16:7982517-7982539 TTTTTCTATAAGCTAGAGTTTGG + Intergenic
1137385841 16:48041840-48041862 ATTCCCTAAAAGATGGAGGATGG + Intergenic
1138020909 16:53480487-53480509 ATTTTTTAAAAGTAGGAGAAAGG - Intronic
1138134308 16:54508348-54508370 ATTTTCTAAAGACTGGTGTACGG - Intergenic
1140178062 16:72684872-72684894 ATTTTCTAAAAGCAGCAATTTGG + Intergenic
1140597484 16:76433783-76433805 AACTGCTAAAAGCTGGAGTAAGG + Intronic
1142415625 16:89939564-89939586 GTTTTCTAACAACTGGAGCAGGG - Intergenic
1144363851 17:14522972-14522994 AGATTCTAAAAGCTGGATTAGGG - Intergenic
1146742722 17:35300834-35300856 ATTTTATAAAAGGGAGAGTATGG + Intergenic
1148284869 17:46379679-46379701 TTCTTCTAAAAGCTGGAATGAGG - Intergenic
1148307090 17:46597601-46597623 TTCTTCTAAAAGCTGGAATGAGG - Intronic
1148974554 17:51515702-51515724 ATTTTACGAAAGCTGGAGTTTGG + Intergenic
1149891873 17:60397192-60397214 ATTATCTAGAAACTGAAGTAAGG - Intronic
1150136747 17:62700001-62700023 ATTTTCTAAAAAATGGAGGGAGG - Intergenic
1151414980 17:73956179-73956201 TTCTTCTAGAAGCAGGAGTAAGG - Intergenic
1151602032 17:75111897-75111919 CTGCTCTAAATGCTGGAGTATGG + Intronic
1151852531 17:76699444-76699466 ATGTTCTTAAAGCTGGATGAGGG - Intronic
1153097542 18:1425223-1425245 ATTTTCCAAAAGCATGAGCAAGG + Intergenic
1154030416 18:10748684-10748706 ATTTTATAAAATCTGAGGTATGG + Intronic
1155496264 18:26445981-26446003 GTTCTCTAAGAGTTGGAGTAAGG + Intergenic
1155652421 18:28158038-28158060 ATTTCATAAAACCTGGAGCATGG + Intronic
1156777033 18:40803616-40803638 ATTTTGCAAAAACAGGAGTAGGG + Intergenic
1157270222 18:46269050-46269072 ATCTTCTAAAAGCTTCAGCAAGG - Intergenic
1157569550 18:48703514-48703536 CTTTTCAAAAAGCTGCTGTATGG + Intronic
1157852155 18:51065125-51065147 ATTTTTTAAAATCTGGAATTTGG - Intronic
1157889219 18:51398983-51399005 ATTTTCTATATGCTTGAGGATGG + Intergenic
1158439047 18:57457414-57457436 ATCTTCTAGAACCTGGGGTAAGG - Intronic
1160369851 18:78363035-78363057 CTTTGCTAAAAGATGGAGTTGGG - Intergenic
1163316409 19:16543075-16543097 CCTTTCTAAAAGCTGCAGTTGGG + Intronic
1163520054 19:17786750-17786772 AGTCTTTAAAAGCTGGAGGAGGG + Intronic
1165102317 19:33446275-33446297 CTCTTCTTAAAGCTGGAGAAAGG - Intronic
1165689545 19:37852831-37852853 TTTTTCTAAATGCTTTAGTAGGG - Intergenic
1166666866 19:44685412-44685434 AACTTCTAGAAGCTGGAGGAGGG + Intergenic
1167809682 19:51817894-51817916 ATTTCCTAAACTCTGGAGCAGGG + Intronic
926031824 2:9597732-9597754 ATTTTCAAAAAAATGAAGTATGG + Intronic
926372903 2:12198383-12198405 ACTTTCTAGAACCTGGAGTCAGG - Intergenic
926883688 2:17577330-17577352 ATTTTTTAAAAGATGGCATATGG + Intronic
927924863 2:27004544-27004566 ATTTCATGATAGCTGGAGTATGG + Intronic
929396050 2:41523537-41523559 ATCTTCTAATTGCTGCAGTATGG + Intergenic
929874909 2:45788268-45788290 ATTTTATGAAAGCTGAAATAGGG - Intronic
930203453 2:48565713-48565735 GTGTTCTAAAGGCTAGAGTAGGG + Intronic
931809038 2:65836320-65836342 ACTTTCTTAAAGCTGAGGTAGGG - Intergenic
931932926 2:67161113-67161135 ATTTTATAGAAGCTGGAGAAGGG - Intergenic
934963193 2:98695622-98695644 GTTTTCTCAAAGCTGCAGTGTGG - Intronic
935390097 2:102541988-102542010 AGTTTATAAACTCTGGAGTATGG + Intergenic
936441384 2:112556970-112556992 ATTTTCAAAAAGCTAGAAGAGGG - Intronic
936892682 2:117391033-117391055 ACTTCCTAGAAGCAGGAGTAGGG + Intergenic
937197528 2:120172867-120172889 ATTTTTTAAAAACTGGAGGGTGG - Intronic
939533378 2:143393364-143393386 ATTTTCTAAAAGATAAATTATGG - Intronic
940833075 2:158490157-158490179 ATTTTTTAAAAGGTGGATTTGGG + Intronic
940856701 2:158734450-158734472 ATTTTCTAAATTCTAAAGTACGG - Intergenic
943169360 2:184377143-184377165 ATTTTTTAAAAGCTGCAGACTGG + Intergenic
945692439 2:213054996-213055018 ATTTTCTAAAAACTGTACTCTGG + Intronic
946049935 2:216854163-216854185 CTTTTCTAAAAGTTGAAGGAAGG - Intergenic
946144847 2:217722913-217722935 TTTTTATAAAAGCTTAAGTAAGG - Intronic
947782787 2:232784684-232784706 AATTTATAAAAGCTGCAATATGG + Intronic
1169798160 20:9487531-9487553 ATTTTCTAAAAGTTGGTGGGAGG - Intergenic
1169986859 20:11454856-11454878 ATTTTCTAAAGTCTGGTGTGGGG - Intergenic
1171337906 20:24403040-24403062 ATGTTCTAAAAACTGGATTGTGG - Intergenic
1173057466 20:39629460-39629482 ATTTTCTTAGAGCAGGAGGAAGG + Intergenic
1173507903 20:43603163-43603185 ATTTTCACAAAGCTGGGGAAGGG - Intronic
1174804785 20:53594835-53594857 ATTTTCTTCAAGCTTGAGGAAGG + Intronic
1175327706 20:58141259-58141281 ATTTTAGAAATGCTGGGGTAGGG + Intergenic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1177034282 21:16022533-16022555 ATTGTCAGAAAGCTGGAGAAAGG + Intergenic
1177354809 21:19994828-19994850 ATTTTCTAGAGGCTGAACTATGG - Intergenic
1177860707 21:26450181-26450203 ATTTTCTCAAAGTGGGAGCATGG + Intergenic
1179003844 21:37491622-37491644 AATTTTTAAAAATTGGAGTAGGG + Intronic
1179282533 21:39946159-39946181 TTTTTCAACATGCTGGAGTAGGG - Intergenic
1180027189 21:45172962-45172984 ATTTTCTCAAATGAGGAGTATGG - Intronic
1182819747 22:33205358-33205380 ACTTTTTAAAAGCTGAATTAGGG - Intronic
1185004791 22:48269548-48269570 GTTTTGTATAAGATGGAGTAGGG - Intergenic
949135775 3:563290-563312 ATTTTATGAAAGATGCAGTAAGG + Intergenic
949698509 3:6727955-6727977 ATTTTCAAAAAGCTAGAAAAGGG + Intergenic
949848697 3:8398938-8398960 GTTTTGGAAAAGCTGGAATAGGG - Intergenic
950374031 3:12555819-12555841 AACTTCAAAATGCTGGAGTAAGG - Intronic
950492776 3:13316338-13316360 ATTTTTCTAAAGCTGGAGAAAGG - Exonic
951305969 3:21062817-21062839 AGCTTCTAAAAGCTGGCCTATGG - Intergenic
951610486 3:24486979-24487001 AATTTATATAAGCTGGAGAATGG - Intronic
951989015 3:28655051-28655073 ATTTTCTAAAAGATGCAGAAAGG - Intergenic
953156644 3:40381181-40381203 ACTTTTTAAAAGGTGGAATAAGG + Intergenic
953614335 3:44476999-44477021 ATTTTTAAAAAGCAGTAGTATGG + Intronic
953960691 3:47263658-47263680 CTTTTCCTGAAGCTGGAGTAGGG - Intronic
953971555 3:47352418-47352440 ATCTTTTAGAAGCTGGATTATGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955386717 3:58486656-58486678 ATTGTCCACATGCTGGAGTATGG + Intergenic
955705392 3:61722380-61722402 AGTTTCTAAAAGCTGAACTTTGG + Intronic
956004981 3:64769240-64769262 ATTTTCAAATGGCTGGAGTGGGG + Intergenic
956020560 3:64929090-64929112 ATTTTGTAAATTCTGGAGAATGG - Intergenic
956106525 3:65824470-65824492 GTTTTCTAACAGCTGTAGTTTGG - Intronic
956275284 3:67493526-67493548 ATTTTGTAAAACCTGTAGGATGG - Intronic
957163616 3:76642029-76642051 AGTTTTTAAAAGCTGACGTAGGG + Intronic
958084471 3:88789028-88789050 ATTTTCCAAAAGCAGCAGTTAGG - Intergenic
959552071 3:107672553-107672575 ATTATTTAGAAGCTGAAGTAGGG + Intronic
959827655 3:110818496-110818518 ATTTTTTAAAAACTGAAGAAAGG - Intergenic
959960956 3:112297052-112297074 ATTTTTTAAAAGGTGGGGGATGG - Intergenic
962185967 3:133259758-133259780 GTTTACTAATACCTGGAGTATGG + Intronic
962955118 3:140258586-140258608 ATTTGCTCAAAGCTGAAGGAAGG + Intronic
962989490 3:140565434-140565456 ATTATCCAAAAGCTGGAGGGAGG + Intronic
963499677 3:146109700-146109722 ATTTTCTAAAGGCTGGACTGAGG + Intronic
964949710 3:162275104-162275126 ATTTTCTTGAATCTGTAGTATGG + Intergenic
965028799 3:163336277-163336299 ATTTGTTAGAAACTGGAGTAAGG - Intergenic
965167406 3:165212762-165212784 ATTTGCTAAATGCTGGACTTGGG + Intergenic
966459211 3:180156638-180156660 AGTTTCAAAAAGCTGGAAAAGGG - Intergenic
972214747 4:36883788-36883810 ATTTTCAAAGAGCTGTAGCAGGG - Intergenic
972999341 4:44926479-44926501 AATGTCTAAAAGCAGGAATAAGG + Intergenic
975404943 4:73978319-73978341 ATCTTCTAAAAAGTGGAATATGG + Intergenic
976136188 4:81938497-81938519 ATATCCAAAATGCTGGAGTAGGG + Intronic
976911265 4:90309103-90309125 ATTTTCTAAAAGTGGAAGCATGG + Exonic
977390569 4:96403599-96403621 TTTCTCTAAAGGCTTGAGTAGGG - Intergenic
977691884 4:99920892-99920914 TTTTTATAAAAGCTAAAGTATGG - Intronic
977708900 4:100101973-100101995 ATTTTTTAAAAAATGGAGTCAGG + Intergenic
977890304 4:102302384-102302406 ATTTGCCAAAAGCTTGTGTAAGG + Intronic
978383453 4:108155444-108155466 ATTTTCTAAAGGTTTGTGTAAGG + Intronic
978754585 4:112288089-112288111 AATTTCTAAAAGCTTGAATAAGG + Intronic
978895224 4:113878806-113878828 ATATTCTAAAAGTTGGACTTAGG + Intergenic
979961944 4:127031157-127031179 ATTTTCTAAAATCCGTAGTGGGG - Intergenic
980709275 4:136542873-136542895 TTTTTCCAAAAACTGCAGTATGG + Intergenic
980990400 4:139734594-139734616 ATTTTCTAAAGGCTAGAGTGAGG + Intronic
981784099 4:148458147-148458169 ATTATCTAAAAGTTGAAGTCAGG - Intergenic
981883194 4:149640812-149640834 ATTTTCTGAAAGGTGGATCAGGG - Intergenic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
983756593 4:171345764-171345786 ACTTTCTAAATGCATGAGTATGG - Intergenic
984777923 4:183499899-183499921 GTTTTCTAAAAGCAGGGGAAAGG - Intergenic
984996745 4:185439338-185439360 ATGTCCTACAAGCTGGAGAAAGG + Intronic
987432027 5:17846188-17846210 ATTTTCTAGACCATGGAGTAGGG - Intergenic
987770677 5:22299704-22299726 TTTATCTAACAGCTGGAATAAGG - Intronic
988856166 5:35229981-35230003 AGTTTGTAAAAGCTGGGGTTGGG + Intronic
989483150 5:41956210-41956232 ATGTTCAAGAAGCTGGAGTAAGG + Intergenic
989814862 5:45723510-45723532 ATTTTCTAGTAGAGGGAGTATGG + Intergenic
990682610 5:58262319-58262341 ATTTTCTAACATCTGGTGTTGGG + Intergenic
991427751 5:66509148-66509170 ATACTCTAAAACCTGGAGGAGGG - Intergenic
991588945 5:68228733-68228755 ATTATTTAAAAGGTGGAATAAGG + Intronic
992218705 5:74550437-74550459 ATTTTCTAAAGCATGGAGTTTGG - Intergenic
992699288 5:79324665-79324687 ATTTTTTAAAAGATGAAGAATGG + Exonic
993465197 5:88236830-88236852 ATATTCTAAAAGACGAAGTATGG + Intronic
993914933 5:93732644-93732666 ATTATCTAAATGGGGGAGTACGG - Intronic
995135404 5:108674835-108674857 ATTTTCTTAAAGCTGAACTGTGG + Intergenic
995433963 5:112114780-112114802 ATTTTCTAAAAATTGCAATATGG - Intergenic
997139190 5:131360960-131360982 CTTTTTTAAAAGCTGGATTGTGG + Intronic
998285811 5:140859771-140859793 AATTTCTAAGAGCTGGAGACAGG - Intronic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
1000538197 5:162505744-162505766 ATTCTCTTAGAGCTGGAGAAAGG + Intergenic
1000623137 5:163507451-163507473 ATTGTCTAAACTCTGAAGTACGG - Intronic
1000772242 5:165369170-165369192 ATGTACTTAAAGCTGGAGTCTGG + Intergenic
1000843062 5:166245711-166245733 TTTATCAAAAAGCTGGATTAAGG + Intergenic
1003579213 6:7324433-7324455 ATTTTTTAAAGGCTAGGGTAGGG + Intronic
1003793635 6:9575520-9575542 ATTTTCTAAAGGTTGAAGAAAGG + Intergenic
1003986045 6:11436249-11436271 ATATTCTAAATGCTGGGGCAAGG + Intergenic
1007441694 6:41866681-41866703 ATCTTCTAAAGTCTGGATTAAGG + Intronic
1008170246 6:48196189-48196211 ATTTTCTATAAGATGGAATTTGG + Intergenic
1010595540 6:77758537-77758559 ATTTTCTTAAAGTTTGAGAAAGG - Intronic
1011953096 6:92992271-92992293 GTTTTCTAAAAGATGGAATTTGG - Intergenic
1012138204 6:95585478-95585500 ATTTTTTAAAAGTTTGTGTAGGG + Intronic
1012259050 6:97066685-97066707 ATTTTTTAAAGGCTGAAATAAGG - Intronic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1016016797 6:139194527-139194549 ATTTTCTAAAACTTTGGGTATGG - Intergenic
1018693514 6:166369991-166370013 TGTTTCTAAAAACAGGAGTAGGG + Intronic
1019655248 7:2190400-2190422 AGTTTCTAAAAGCTTGGGTTAGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020765761 7:12318600-12318622 ATTTCCAAAAAGCTGCATTAAGG + Intergenic
1022233825 7:28441961-28441983 ATTTTCAAAAAGCTAGAAGAGGG - Intronic
1023368353 7:39487675-39487697 ATTTTCTGAAGGCTGGAGAGAGG - Intronic
1023685823 7:42734217-42734239 ATTTACTAAAAGCAAGAGAAAGG - Intergenic
1023925480 7:44666246-44666268 AATGTCAAAAAGCTGGAGGAGGG - Intronic
1024274113 7:47663870-47663892 ATTTTCTAAAAACTGAAGAAAGG - Intergenic
1024778868 7:52822511-52822533 ATTTACTGAGAACTGGAGTAAGG - Intergenic
1024832331 7:53475474-53475496 CTTTTCTTAAATCTAGAGTACGG + Intergenic
1024890656 7:54197937-54197959 ATGTTCTAACAGGGGGAGTAGGG + Intergenic
1027948789 7:84785328-84785350 ATATTCTAAAACCTGAAATAGGG - Intergenic
1028216228 7:88136953-88136975 ACTTTTTAAAAGCTGGATAATGG - Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028667595 7:93364534-93364556 ATTTTCTAAAAACTGAAACAAGG - Intergenic
1029038230 7:97545368-97545390 ATTTTCTAAAATGAGGAATAAGG + Intergenic
1029264985 7:99331615-99331637 ATTTTTTAAAATGTGGATTATGG + Intronic
1029835690 7:103307186-103307208 ATTTTTAAAAAGCTGGAGCTGGG - Intronic
1029884528 7:103853945-103853967 ATTTTCAAAAAGCTAGAAGAAGG + Intronic
1029900090 7:104030198-104030220 ATTTTTTAAATGTTAGAGTAGGG + Intergenic
1030777654 7:113554121-113554143 TTTTTCTAAGAGCAGGAATAAGG + Intergenic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1031531595 7:122883688-122883710 ATTTTTTAAAAGGTGGGGGAGGG + Intronic
1032700179 7:134372438-134372460 AATTTCTGCAAGCTGGAATATGG + Intergenic
1033216526 7:139497294-139497316 ATTTTCTAAAAGTTGGTATCTGG + Intergenic
1034440726 7:151084537-151084559 ATTTTTTAAAAGATGTACTATGG + Intergenic
1034658021 7:152744712-152744734 ATTTTCACAAAGCTGGATTCTGG - Intergenic
1035772301 8:2157189-2157211 ATTTTTTAAAAGCTTGCTTATGG - Intronic
1036042725 8:5103989-5104011 ACTTTTAAAAAGCTGGAGTGGGG - Intergenic
1036213690 8:6862821-6862843 ATTCTCTAGTAGCTGGAGGAAGG + Intergenic
1037579108 8:20234288-20234310 CTGTTCTAAAAGCTGGGGTTTGG - Intergenic
1040419819 8:47228448-47228470 ACTGTCGACAAGCTGGAGTACGG + Intergenic
1041342591 8:56861822-56861844 ATGTTTTAAAAACTGGATTATGG + Intergenic
1042663747 8:71183533-71183555 CTTTTCTAAAACCTGGAGAAGGG - Intergenic
1042869263 8:73382639-73382661 ATTCCTTCAAAGCTGGAGTAGGG + Intergenic
1043660605 8:82736165-82736187 ATTTTCTAAAATCTAGATGAAGG - Intergenic
1044041896 8:87379787-87379809 ATTTTCTAAAAAATGAAATAAGG + Intronic
1044313606 8:90725320-90725342 TTTTTTTAAAAACTGGAGTGTGG - Intronic
1044474432 8:92609520-92609542 ATTTTCTCAATTCTGGAGTCTGG + Intergenic
1046182000 8:110661920-110661942 ATTCTCCAAATGCTGGAGCAGGG - Intergenic
1047983716 8:130211169-130211191 ATTTTCTATAATGTGGAGGAGGG + Intronic
1050765173 9:9123993-9124015 ATTGTCTAAAAGGTGGGGTGGGG + Intronic
1051523710 9:18019074-18019096 GTTTTCGAAAAACTGGAGGAAGG + Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1055317921 9:75052788-75052810 ATTTTCTAAAACTTGGGGTCTGG - Intergenic
1055650951 9:78406624-78406646 CTTTTCTAAAAGCTCGGGAATGG - Intergenic
1056596395 9:88011264-88011286 ACTTTCTAAAAGCTGCTTTAAGG + Intergenic
1056810278 9:89758452-89758474 ATTTTTTGAAAGCTGCACTAGGG - Intergenic
1057800536 9:98188450-98188472 ATTTTCTAAGTGCTGGGGAAAGG - Intronic
1058228374 9:102394999-102395021 AGTTTTTGAAAGCTGGAGTTGGG + Intergenic
1058514519 9:105756195-105756217 ATTTTCTATATGCAGGATTATGG + Intronic
1058587261 9:106522893-106522915 CTATTCTAAAAGATGGAGGAGGG + Intergenic
1059109829 9:111545511-111545533 ATGTTCTAAAAAATGGATTATGG - Intronic
1059608758 9:115868875-115868897 ATTTTCAAATAGCTGGAAGAGGG + Intergenic
1186207987 X:7220039-7220061 ACTGTCTAAAAGGTGGAGTGAGG + Intronic
1188661735 X:32768823-32768845 ATACTTTAAAAGCTGGAGAAAGG - Intronic
1189717079 X:43878003-43878025 ATTTCCAAAAAGGTAGAGTAAGG + Intronic
1190832045 X:54067555-54067577 ATTTTATTATGGCTGGAGTACGG + Intergenic
1192564052 X:72147976-72147998 ATTTTCTATATTCTGGAGTTAGG - Intergenic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1192981487 X:76349309-76349331 AATTACTGAAAGCTGGAGAAAGG - Intergenic
1193106481 X:77680137-77680159 ATTTTATAAAAGCTCCAGTGGGG - Intronic
1194056537 X:89141428-89141450 AGTTTCCAAAAGCTGGAGACAGG - Intergenic
1194621065 X:96172736-96172758 ATTTCCTTAAATCTGCAGTAAGG + Intergenic
1195024722 X:100864907-100864929 ACTTTCTAAAAGGAGGGGTATGG + Intronic
1195153245 X:102096110-102096132 ATTTTCAAAAAGCTAGAAGAGGG + Intergenic
1195703165 X:107720133-107720155 TTTTCCTAAAAGCTGGAATAGGG - Intronic
1197263441 X:124340654-124340676 ATTTTATAAACACTGGGGTATGG - Intronic
1198516758 X:137416397-137416419 AGTATCTAAAAGCAGAAGTAGGG + Intergenic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1199154626 X:144532934-144532956 TTTTTCCAAAAAGTGGAGTATGG + Intergenic
1199214603 X:145250510-145250532 TGTTTTTAAAAGCTGGAGTAGGG + Intronic
1199420801 X:147642412-147642434 ATGTTCTAAAACCTTGAGAATGG - Intergenic
1200794643 Y:7329670-7329692 ATTTTCTAAAAACTGGAAACAGG + Intergenic
1201337689 Y:12897932-12897954 ATGTTCTTACAGCTGAAGTAGGG + Intergenic