ID: 1199075931

View in Genome Browser
Species Human (GRCh38)
Location X:143526069-143526091
Sequence CCAAAACCTGAATAAACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199075931_1199075936 9 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075936 X:143526101-143526123 TGCAAACTTGGTAGGTGGTATGG No data
1199075931_1199075937 10 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075937 X:143526102-143526124 GCAAACTTGGTAGGTGGTATGGG No data
1199075931_1199075933 -3 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075933 X:143526089-143526111 TGGATATCTTCATGCAAACTTGG No data
1199075931_1199075934 1 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075934 X:143526093-143526115 TATCTTCATGCAAACTTGGTAGG No data
1199075931_1199075935 4 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075935 X:143526096-143526118 CTTCATGCAAACTTGGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199075931 Original CRISPR CCAAAACCTGAATAAACCAA AGG (reversed) Intergenic
No off target data available for this crispr