ID: 1199075933

View in Genome Browser
Species Human (GRCh38)
Location X:143526089-143526111
Sequence TGGATATCTTCATGCAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199075931_1199075933 -3 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075933 X:143526089-143526111 TGGATATCTTCATGCAAACTTGG No data
1199075930_1199075933 -2 Left 1199075930 X:143526068-143526090 CCCTTTGGTTTATTCAGGTTTTG No data
Right 1199075933 X:143526089-143526111 TGGATATCTTCATGCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199075933 Original CRISPR TGGATATCTTCATGCAAACT TGG Intergenic