ID: 1199075933 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:143526089-143526111 |
| Sequence | TGGATATCTTCATGCAAACT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1199075931_1199075933 | -3 | Left | 1199075931 | X:143526069-143526091 | CCTTTGGTTTATTCAGGTTTTGG | No data | ||
| Right | 1199075933 | X:143526089-143526111 | TGGATATCTTCATGCAAACTTGG | No data | ||||
| 1199075930_1199075933 | -2 | Left | 1199075930 | X:143526068-143526090 | CCCTTTGGTTTATTCAGGTTTTG | No data | ||
| Right | 1199075933 | X:143526089-143526111 | TGGATATCTTCATGCAAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1199075933 | Original CRISPR | TGGATATCTTCATGCAAACT TGG | Intergenic | ||
| No off target data available for this crispr | |||||