ID: 1199075935 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:143526096-143526118 |
Sequence | CTTCATGCAAACTTGGTAGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1199075931_1199075935 | 4 | Left | 1199075931 | X:143526069-143526091 | CCTTTGGTTTATTCAGGTTTTGG | No data | ||
Right | 1199075935 | X:143526096-143526118 | CTTCATGCAAACTTGGTAGGTGG | No data | ||||
1199075930_1199075935 | 5 | Left | 1199075930 | X:143526068-143526090 | CCCTTTGGTTTATTCAGGTTTTG | No data | ||
Right | 1199075935 | X:143526096-143526118 | CTTCATGCAAACTTGGTAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1199075935 | Original CRISPR | CTTCATGCAAACTTGGTAGG TGG | Intergenic | ||