ID: 1199075937

View in Genome Browser
Species Human (GRCh38)
Location X:143526102-143526124
Sequence GCAAACTTGGTAGGTGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199075930_1199075937 11 Left 1199075930 X:143526068-143526090 CCCTTTGGTTTATTCAGGTTTTG No data
Right 1199075937 X:143526102-143526124 GCAAACTTGGTAGGTGGTATGGG No data
1199075931_1199075937 10 Left 1199075931 X:143526069-143526091 CCTTTGGTTTATTCAGGTTTTGG No data
Right 1199075937 X:143526102-143526124 GCAAACTTGGTAGGTGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199075937 Original CRISPR GCAAACTTGGTAGGTGGTAT GGG Intergenic
No off target data available for this crispr