ID: 1199079142

View in Genome Browser
Species Human (GRCh38)
Location X:143557004-143557026
Sequence GCTCACAGGAAGCCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199079138_1199079142 28 Left 1199079138 X:143556953-143556975 CCAGAAGAAATTCAGGGTAAGTG No data
Right 1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG No data
1199079139_1199079142 1 Left 1199079139 X:143556980-143557002 CCTCAACTACTGCCTAATAGATC No data
Right 1199079142 X:143557004-143557026 GCTCACAGGAAGCCACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199079142 Original CRISPR GCTCACAGGAAGCCACAGCC AGG Intergenic
No off target data available for this crispr