ID: 1199079573

View in Genome Browser
Species Human (GRCh38)
Location X:143561582-143561604
Sequence ATCTAGAGGCCCCTGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199079573_1199079581 26 Left 1199079573 X:143561582-143561604 CCTCCCAACAGGGGCCTCTAGAT No data
Right 1199079581 X:143561631-143561653 CATCAGGTCAGTGCACCTCTGGG No data
1199079573_1199079579 10 Left 1199079573 X:143561582-143561604 CCTCCCAACAGGGGCCTCTAGAT No data
Right 1199079579 X:143561615-143561637 GGAGAGTTCTTGTCAGCATCAGG No data
1199079573_1199079580 25 Left 1199079573 X:143561582-143561604 CCTCCCAACAGGGGCCTCTAGAT No data
Right 1199079580 X:143561630-143561652 GCATCAGGTCAGTGCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199079573 Original CRISPR ATCTAGAGGCCCCTGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr