ID: 1199081597

View in Genome Browser
Species Human (GRCh38)
Location X:143582890-143582912
Sequence ATTTGCCAGTAGAAGTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199081594_1199081597 16 Left 1199081594 X:143582851-143582873 CCTAAGAAGGTCGTGGTGAGACT No data
Right 1199081597 X:143582890-143582912 ATTTGCCAGTAGAAGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199081597 Original CRISPR ATTTGCCAGTAGAAGTGAAA TGG Intergenic
No off target data available for this crispr