ID: 1199087105

View in Genome Browser
Species Human (GRCh38)
Location X:143640083-143640105
Sequence CCCCTGTGAAAACGAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199087105_1199087112 29 Left 1199087105 X:143640083-143640105 CCACATTTTCGTTTTCACAGGGG No data
Right 1199087112 X:143640135-143640157 AATAGACTTGAAAGCTGGGCAGG No data
1199087105_1199087110 24 Left 1199087105 X:143640083-143640105 CCACATTTTCGTTTTCACAGGGG No data
Right 1199087110 X:143640130-143640152 AGCAGAATAGACTTGAAAGCTGG No data
1199087105_1199087113 30 Left 1199087105 X:143640083-143640105 CCACATTTTCGTTTTCACAGGGG No data
Right 1199087113 X:143640136-143640158 ATAGACTTGAAAGCTGGGCAGGG No data
1199087105_1199087111 25 Left 1199087105 X:143640083-143640105 CCACATTTTCGTTTTCACAGGGG No data
Right 1199087111 X:143640131-143640153 GCAGAATAGACTTGAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199087105 Original CRISPR CCCCTGTGAAAACGAAAATG TGG (reversed) Intergenic
No off target data available for this crispr