ID: 1199093021

View in Genome Browser
Species Human (GRCh38)
Location X:143713262-143713284
Sequence GAGAATAAGGAGAATGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199093021_1199093025 -4 Left 1199093021 X:143713262-143713284 CCAGTCCCATTCTCCTTATTCTC 0: 1
1: 0
2: 4
3: 47
4: 458
Right 1199093025 X:143713281-143713303 TCTCTAGTCTTCTCCAGACCTGG 0: 1
1: 1
2: 0
3: 15
4: 158
1199093021_1199093026 -3 Left 1199093021 X:143713262-143713284 CCAGTCCCATTCTCCTTATTCTC 0: 1
1: 0
2: 4
3: 47
4: 458
Right 1199093026 X:143713282-143713304 CTCTAGTCTTCTCCAGACCTGGG 0: 2
1: 0
2: 2
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199093021 Original CRISPR GAGAATAAGGAGAATGGGAC TGG (reversed) Intronic
900707086 1:4087579-4087601 GATTATCAGGAGAGTGGGACTGG - Intergenic
901757499 1:11450251-11450273 AAGAAGAAGGAGACAGGGACAGG + Intergenic
902671087 1:17974328-17974350 GAAAATCAGGAAAATGGGACAGG + Intergenic
902733550 1:18385411-18385433 GACAGTAAGGAGAAAGAGACTGG + Intergenic
902995860 1:20224158-20224180 GGGAAAGAGGAGAATGGGAAGGG - Intergenic
903911747 1:26731852-26731874 GAAATTAAAGATAATGGGACTGG + Intronic
905342412 1:37288304-37288326 GGGAGCAAAGAGAATGGGACAGG + Intergenic
906127383 1:43435454-43435476 GAGAGCAAGGAGGATAGGACAGG + Intronic
906238004 1:44223351-44223373 GACAGGAAGGGGAATGGGACCGG + Intronic
906606734 1:47178010-47178032 GAGAAAAAGGGGAATGAGACAGG - Intergenic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908343115 1:63203322-63203344 GAGAATAATGTCAATGGAACTGG - Intergenic
909520153 1:76558594-76558616 TAGAGTAGGGAGAATGGGAGGGG + Intronic
909531633 1:76688412-76688434 GAGACTAAGGAGACTAAGACGGG + Intergenic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
911092601 1:94029734-94029756 GAGAATAAGAAGAAAGGGCCTGG - Intronic
912075286 1:105866831-105866853 GAGAATAAGGAGAAAGGAATAGG + Intergenic
913184828 1:116360863-116360885 GAGAACAAAGAGAATAGGACGGG + Intergenic
913382698 1:118228520-118228542 GAGAGTACAGAAAATGGGACAGG + Intergenic
913401802 1:118443119-118443141 GAGATTATGGAGAATGGGGGAGG + Intergenic
914096275 1:144546797-144546819 GAGCAGAAGGAGACTGGGAAAGG - Intergenic
914302241 1:146387166-146387188 GAGCAGAAGGAGACTGGGAAAGG + Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
915166444 1:153950551-153950573 GAGAACAAGAAGAAAAGGACAGG + Intronic
915708957 1:157875050-157875072 GAGAGTAAGGAAATTGGGATAGG - Intronic
916281120 1:163052718-163052740 TAGAATAATGACAATGGGAATGG - Intergenic
916790884 1:168124134-168124156 GGGGTTGAGGAGAATGGGACAGG - Intronic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
920209766 1:204319831-204319853 GAGAGAAGGGAGAAAGGGACAGG + Intronic
920400828 1:205675388-205675410 GAGAATAAGGGGTAAGAGACAGG + Intronic
920677032 1:208045281-208045303 GAGATTAAGGAGACGGGGAAGGG + Intronic
922029829 1:221787215-221787237 AAGAAAAAAGAGAATGGGACTGG + Intergenic
923072434 1:230577883-230577905 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
923090678 1:230738704-230738726 GAGAAAATGGAGAGTGGGAAAGG + Intergenic
923168888 1:231394687-231394709 GTGAATAAGAAAATTGGGACTGG - Intronic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923532405 1:234821889-234821911 GAGAGCAAGGAGAATGTGAGTGG - Intergenic
924437983 1:244061895-244061917 GTGATGAGGGAGAATGGGACAGG + Intergenic
1062858183 10:789995-790017 GCGAACAAGGAGCATGGGGCTGG - Intergenic
1063729636 10:8681611-8681633 GAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1065385279 10:25127845-25127867 GAGAATAAGCAAAAAGGGATGGG + Intergenic
1066354546 10:34669442-34669464 GAGACTCAGGAGGATGGGAGGGG + Intronic
1067021158 10:42799400-42799422 GAGAATAGAGAGAAAGGGGCTGG - Intronic
1067977639 10:51043811-51043833 GAGAATAAAGACAATGGCATTGG + Intronic
1068287360 10:54957610-54957632 GAGATCAAGCAGAATGGTACTGG + Intronic
1068867321 10:61908505-61908527 GAGATTAAGGAGAATGGCCTCGG + Intronic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1070495307 10:77015930-77015952 GAGAATGAGAGGAATGGGGCAGG - Intronic
1070956161 10:80464884-80464906 GAGAAGGAGGAGAGTGGGAGAGG + Intronic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1072456907 10:95584454-95584476 TAGAACAAGGAGTATGGGCCAGG - Intergenic
1072536492 10:96368274-96368296 GAAAATGAGGAGGATGGGACAGG + Intronic
1073060392 10:100730244-100730266 GAGATTAAGAAGGAAGGGACAGG - Intergenic
1073576392 10:104629613-104629635 GAGATTAAGGAGATGGGGACAGG + Intergenic
1074909665 10:117896415-117896437 GAAAATAATGAGAAGGGGACAGG + Intergenic
1074924447 10:118053184-118053206 GAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1077842566 11:5991419-5991441 GAGATTAAAGAGAGAGGGACAGG + Intergenic
1078845663 11:15116602-15116624 GAGAATAGCCAGGATGGGACAGG - Intronic
1079231205 11:18650273-18650295 GGGACTGAGGAGAATGGGTCTGG + Intergenic
1079381054 11:19937857-19937879 GAGAATAAGGAGAGTGCTATAGG + Intronic
1079391395 11:20024838-20024860 AAAACTAAGTAGAATGGGACAGG - Intronic
1079891647 11:26063276-26063298 GAGAATGAGTAGAATCTGACAGG - Intergenic
1080705282 11:34686032-34686054 GAGAAGCAGAAGAATAGGACCGG - Intergenic
1081633500 11:44705168-44705190 GAAAATAAAGAAAATGGGAGGGG - Intergenic
1083480481 11:62941976-62941998 GATAGTAAGGAAAATGGGGCCGG - Intronic
1083831310 11:65235613-65235635 GAAAATGAGGACAATGGGCCGGG + Intergenic
1085007384 11:73105295-73105317 GAGAATAAGGACAATGAAACAGG + Intronic
1085330821 11:75649431-75649453 GGGAAGAAGCAGAATGGGTCTGG + Intronic
1085860338 11:80225934-80225956 GATAATAAAGATAATGAGACTGG + Intergenic
1085928707 11:81055056-81055078 GAGCCAAAGGAGAATGGGAAAGG + Intergenic
1086578642 11:88370388-88370410 GAAAATAATGCGAATGGGCCAGG + Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087930513 11:103972418-103972440 AATAAAAAGGAGAATGAGACAGG - Intronic
1088860525 11:113794892-113794914 GACAAACAGGATAATGGGACAGG + Intergenic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1090480242 11:127061491-127061513 GAGGGTGAGGAGAATGGGACAGG - Intergenic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1091642466 12:2247807-2247829 GAGAATAAAGAGAAAGGAGCAGG - Intronic
1091966279 12:4745071-4745093 GAGAATGTGGAGAATCAGACAGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092629912 12:10365986-10366008 AAGAATAAGGAGAATGGTCAAGG + Intergenic
1093155699 12:15681906-15681928 AAGAATAAGGACTATGGGAGGGG + Intronic
1094283644 12:28768255-28768277 GAGAAAAAGGAGAAAGACACTGG + Intergenic
1094443151 12:30501457-30501479 GAGAATAGGAGGAATGGGAATGG - Intergenic
1095429648 12:42119433-42119455 GAGAAGAAAGAGAAAGGGAAAGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096113080 12:49040416-49040438 GAGAATAAGGGTCAGGGGACTGG + Exonic
1096115824 12:49054505-49054527 GTGAGTGAGGAGAATGGGGCAGG - Intronic
1096636674 12:52964826-52964848 GAGCATAACCAGATTGGGACAGG + Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1098647513 12:72921832-72921854 GAGAAAAAAGAGAATGTGATTGG + Intergenic
1098657982 12:73057209-73057231 AAGAATAAGAAGAATGGGCTTGG - Intergenic
1099451514 12:82813491-82813513 GAGAATAAGCAGAATGGTTAAGG - Intronic
1099851478 12:88102506-88102528 GAGAAAAAGGAGCATGAAACAGG - Intronic
1100227106 12:92569719-92569741 GAGGATAAGAGGAGTGGGACAGG + Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1101282025 12:103267800-103267822 GAGAGGAAGTAGAATGGGATGGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102435409 12:112918998-112919020 GAGAATAGGGAGAAGTGAACAGG + Intronic
1102852254 12:116259534-116259556 GAGAGAAAAGAGAATGGGAGAGG + Intronic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1107049461 13:36031963-36031985 GAGAAAAAAGGGAAGGGGACAGG + Intronic
1108192482 13:47956438-47956460 GAAGAAAAGGAGAATGGGACAGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108954966 13:56141767-56141789 GAGAAAAGGGAGCATGGAACAGG - Intergenic
1109773103 13:67003078-67003100 GAGACTGAGGAAAATGGGTCTGG - Intronic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111586303 13:90288446-90288468 GAGTATATGGAGAGTGTGACAGG + Intergenic
1112694366 13:101931245-101931267 GAGAATGAAGAGGATGGGAAGGG - Intronic
1113406586 13:110046492-110046514 GAGGATTAGGGGATTGGGACGGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114791663 14:25666475-25666497 GAGAAACAGGAGAAAGGGATAGG - Intergenic
1115679595 14:35721653-35721675 GAAAATCATGAGAATGGTACAGG - Intronic
1117649066 14:57883033-57883055 GAGAAGGAGGAGAAGGGGAGGGG + Intronic
1119764740 14:77181417-77181439 GGGACTAAGGAGACTGGGAAAGG + Intronic
1120281437 14:82443615-82443637 GAGAAGATGGAGAAGGGGAAGGG - Intergenic
1121160193 14:91731311-91731333 GAAAATAAGAAGAATGAGACTGG - Intronic
1122006211 14:98705950-98705972 GAGAATAAGCAGAAATGGCCGGG + Intergenic
1122430328 14:101636062-101636084 GAGAATAACGTGAAGGGAACTGG + Intergenic
1122561989 14:102622367-102622389 GAGGGTAGGGAGAGTGGGACTGG - Intronic
1202940794 14_KI270725v1_random:143570-143592 GAGAAGCAGGAGCATGGGAGGGG + Intergenic
1123703223 15:22931309-22931331 GTGAGTGAGGAGAATGGGAGTGG + Intronic
1124260727 15:28188065-28188087 GAGAATATGAAGAATGCTACAGG + Intronic
1125053622 15:35331630-35331652 CAGAGTGAGGAGAATGAGACAGG + Intronic
1126980908 15:54241700-54241722 GAGAAAAGGGGGAATGGGAAGGG - Intronic
1128047349 15:64630366-64630388 GAAAATTAGGAGGATGGTACTGG - Intronic
1128194833 15:65743270-65743292 GAGAATAAAGAGATTGGAATTGG - Intronic
1129897822 15:79121752-79121774 GAGACTAAGGGGAAGGGGCCTGG - Intergenic
1130298661 15:82664376-82664398 GAGGATGAGGAGAAAGGGAGAGG - Exonic
1131035899 15:89221853-89221875 GAGAAAAGAGGGAATGGGACTGG - Intergenic
1131084628 15:89566013-89566035 AAGAATAGCGAGAATGGGCCGGG - Intergenic
1131533684 15:93216115-93216137 GAGAATAACAACAATGGAACTGG - Intergenic
1132042564 15:98537244-98537266 GACAGCAAGGAGCATGGGACAGG + Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135917732 16:26621255-26621277 GAGAAGAAGGAAAGAGGGACAGG + Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138722210 16:59095605-59095627 GAGAATAATGATAATGGGTTGGG - Intergenic
1139127956 16:64104231-64104253 CAGAATGGGTAGAATGGGACAGG - Intergenic
1140416223 16:74775368-74775390 GACAATAGGGAGAATGGGAGGGG - Intergenic
1141140889 16:81496121-81496143 TAGAATGGGGATAATGGGACTGG + Intronic
1141206356 16:81935841-81935863 TAGAAGAGGGAGAATGGGAATGG - Intronic
1141252231 16:82369260-82369282 GAGGAGGAGGAGCATGGGACAGG - Intergenic
1141491364 16:84376082-84376104 GAGAAAGAGGTGGATGGGACAGG + Intronic
1143198061 17:5091763-5091785 GAGAATAATGAGAGTGAGAGAGG + Exonic
1143391289 17:6560774-6560796 GAGAAGGAGGAGAATGAGAAAGG - Intergenic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1144244190 17:13346753-13346775 GAGAAGAAGGAGGATGGAAATGG + Intergenic
1146455227 17:33004450-33004472 GAGAAGGAGGAGAAGGGGAATGG + Intergenic
1146911643 17:36652093-36652115 GAGAAAAAAGAGAAAGGGAAAGG - Intergenic
1147480001 17:40751470-40751492 GAGAATTAGGTCAACGGGACAGG - Intronic
1147504573 17:41002806-41002828 GAGAACACAGAGAATGGGAGAGG - Intergenic
1148074208 17:44926342-44926364 GACAAGAAGGAGGAGGGGACGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149958823 17:61084166-61084188 TACAATAAGTAGAATGGGAGAGG - Intronic
1150868171 17:68876621-68876643 GGGAATAAAGAGAAAGGTACGGG - Exonic
1151410819 17:73927221-73927243 AAGAAGAAGGAGAGAGGGACGGG + Intergenic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1151783138 17:76260934-76260956 GAGGAGAAGGAGAATGGGAAAGG - Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153520911 18:5953168-5953190 GAGCATCAGGAGAAGGGGAAGGG + Intergenic
1153720128 18:7893394-7893416 TAGAACAAGTAGAATGGGAAAGG - Intronic
1155457719 18:26037992-26038014 GAGATTGAGTAGAATGGGAAAGG - Intronic
1156103805 18:33632572-33632594 GAGAAGAAGGAGTTTAGGACTGG - Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156403552 18:36761639-36761661 GAGGATGAGGTGAATGGGAACGG - Intronic
1156509257 18:37621793-37621815 GAGAGTAAGGAGGATGTGAAAGG + Intergenic
1156802276 18:41130680-41130702 GAGAATAATAAGGGTGGGACAGG + Intergenic
1158058088 18:53305521-53305543 GAAAGAAAGGACAATGGGACAGG - Intronic
1158087709 18:53672843-53672865 GAGAATAAGGAGAAAGCTATAGG - Intergenic
1158605797 18:58895033-58895055 GAAAAGAAGGAGAATGGCTCAGG - Intronic
1158744607 18:60185009-60185031 AAGAATAAAGAAAATGGAACAGG + Intergenic
1158989763 18:62856373-62856395 GATAATAAGGAGACAGTGACTGG - Intronic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161485146 19:4531548-4531570 TAGACCAAGGAGGATGGGACAGG + Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163483054 19:17569730-17569752 GAAAATTAGGAGAATGGCCCAGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164053813 19:21605482-21605504 AAGAATAAGGAGAATGGGCCGGG + Intergenic
1164148742 19:22530559-22530581 GAGAAGCGGGAGAATGGGTCTGG - Intronic
1165256704 19:34580603-34580625 ATGAATAAGGAAAAAGGGACAGG - Intergenic
1167250738 19:48397170-48397192 GAGAATGAGGGGATGGGGACAGG + Intronic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1167999636 19:53434509-53434531 GAGAAACAGGAGAATGGGTTTGG + Intronic
1168004002 19:53471334-53471356 GAGAAACAGGAGAATGGGTTTGG + Intronic
925246197 2:2385540-2385562 GAGAATAAGGAGGAAGGAAATGG + Intergenic
925567813 2:5275486-5275508 GATTACAAGGAGAATGGAACAGG - Intergenic
926302253 2:11612791-11612813 GAGAATCAGGAGAAGGGGCACGG - Intronic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926390678 2:12388968-12388990 GAGAAGAGACAGAATGGGACAGG - Intergenic
926644957 2:15280410-15280432 GAGAATAAAGAGGATGGGGAAGG + Intronic
927070766 2:19526975-19526997 TAGAATAGGGAGAATGGGCCAGG + Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927715654 2:25350511-25350533 AAGAAGAAGAAGAATGGCACTGG - Intergenic
927823478 2:26289828-26289850 GAGAACAAGGAGAAAAGTACAGG - Intronic
929117685 2:38457905-38457927 GAGAATGAGGAAAATGTGAGAGG - Intergenic
929355856 2:41023451-41023473 GAGGAAAAGGAGAATGGTAGAGG - Intergenic
929509574 2:42556196-42556218 GAGAAGCAGAAGAATGAGACTGG - Intronic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930722808 2:54654074-54654096 AGGAGTAGGGAGAATGGGACAGG - Intronic
931037559 2:58260396-58260418 GAAAAAAGGCAGAATGGGACTGG + Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932362546 2:71121083-71121105 GAGGAAAAGGAGAAAGGTACTGG - Intronic
935368735 2:102322320-102322342 AAGATTAAGGGCAATGGGACAGG - Intronic
937048053 2:118863291-118863313 GGGAGTAAGGAGAGTGGGGCTGG + Intergenic
937686814 2:124706853-124706875 GAGGAGAAGGAGAAGGGGAAAGG + Intronic
938025831 2:127947035-127947057 GAGAGAAAGGAGGATGGGAGAGG + Intronic
938575133 2:132596535-132596557 GGCAGGAAGGAGAATGGGACTGG - Intronic
938642130 2:133292067-133292089 GAAATTAAGAAGAATGGGATGGG + Intronic
938701771 2:133885965-133885987 GAGACTAAGGAGGATGGGAGGGG - Intergenic
938905695 2:135833894-135833916 GAGAGGAAGGAGAATGGCAGAGG - Intronic
939166438 2:138645950-138645972 GAGAAAAGGGAGACTGGGGCTGG + Intergenic
939266982 2:139886553-139886575 GGGAATAAGGAAAATGTGAAAGG - Intergenic
942104973 2:172624695-172624717 GAGAATAAGAAGGAAGGGGCAGG + Intergenic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942847053 2:180439563-180439585 GAGAATAAGAGGAAAGGGAAGGG + Intergenic
943555991 2:189404454-189404476 GAGAATAAGGAAGTTGGGAGTGG - Intergenic
943921538 2:193713269-193713291 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
944309250 2:198214890-198214912 GAGAATAAAAAGAATTTGACAGG + Intronic
944896016 2:204165645-204165667 TAGAATCAGGAGAGTGGGCCTGG + Intergenic
946111186 2:217419150-217419172 GTGAATAAGGCTAATGGGAGTGG - Intronic
946393423 2:219430268-219430290 GTGAATGAGTAGAATAGGACAGG - Intergenic
946940094 2:224761232-224761254 GAGTAAAGGGAGAAAGGGACAGG + Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947831028 2:233141819-233141841 GAGACTGGGGAGAAGGGGACTGG + Intronic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948946229 2:241221373-241221395 AAGAAAAAAGAGAATAGGACGGG - Intronic
1169110331 20:3028686-3028708 GAGAATCTAGAGAATGGGCCTGG + Intronic
1170654389 20:18272654-18272676 GAAGATAAGGACAATGAGACAGG - Intergenic
1170824986 20:19786000-19786022 GTGAAAAATGAGAATGGGAATGG + Intergenic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1172324461 20:34023759-34023781 GGGAATAAGGAGACTGGTTCTGG - Intronic
1172324510 20:34024052-34024074 GGGAATAAGGAGACTGGTTCTGG + Intronic
1172798095 20:37557125-37557147 GAGATTTAGGAGAGAGGGACTGG + Intergenic
1173575694 20:44111896-44111918 GAGCATGAGGGGAATGGGGCGGG - Exonic
1174183975 20:48692671-48692693 GAGAATGTGGAAGATGGGACAGG - Exonic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1176057159 20:63154877-63154899 GAGAAGAGGGAGAAGGGGAGAGG - Intergenic
1178148179 21:29763695-29763717 AAGAATAAGGAAACTGGAACAGG + Intronic
1178820588 21:35971568-35971590 GAGAGTAAGGAAAATGTGTCAGG + Intronic
1178884411 21:36474033-36474055 GAGAATAGGGACAGAGGGACAGG + Intronic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182084611 22:27552828-27552850 GTGAATAAGGAGAGTGGCATGGG - Intergenic
1182463079 22:30495824-30495846 AAGAAACAGGAGAATGGGACAGG + Intronic
1182708154 22:32301776-32301798 GCTAATAAAGAGAATGGTACTGG + Intergenic
1183305133 22:37078854-37078876 GAGAAGAAGGAGAAGAGGAAGGG + Intronic
1184395858 22:44239260-44239282 GCTAATAAAGAGAATGGTACTGG + Intergenic
1185400065 22:50611031-50611053 GAGAAAAGGGAGACTGGGAAGGG - Exonic
949908840 3:8883087-8883109 GAGAAAAAGGAGTATGTGAGGGG + Intronic
950111490 3:10421542-10421564 GAGAAAAAGGAGACTGGAAGAGG + Intronic
951110646 3:18799736-18799758 GAGAAAAAGGAGGGTGTGACAGG - Intergenic
951481848 3:23169646-23169668 GAGACTAAGGAGCATGGAAGAGG + Intergenic
952401577 3:32968322-32968344 AAGAATAAGGAGAATGGTCAAGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
955534626 3:59909887-59909909 GAGAATATGAAGAAAGGAACAGG + Intronic
955927198 3:64019007-64019029 AAGAAGGAGGAGACTGGGACAGG - Exonic
956147334 3:66204128-66204150 GAAAATCACGAGAATGGGCCGGG + Intronic
956591058 3:70915070-70915092 GAAAAGAAGGAAAATAGGACTGG - Intergenic
957135672 3:76285913-76285935 GAGAATAAAGAGTATGGGTGCGG - Intronic
957243238 3:77685838-77685860 GAGAATGAGGAAGATGGGAAAGG + Intergenic
957825038 3:85430592-85430614 GCGAATAAGGAGAAAGGGGGCGG + Intronic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960262437 3:115582816-115582838 GATAATTAGGGGGATGGGACCGG - Intergenic
960416635 3:117393013-117393035 GAGAAGAAGTAGAGTGGGAAGGG - Intergenic
961007737 3:123416126-123416148 GAGAATCAGCAGAAAGGGACAGG + Intronic
961379111 3:126485949-126485971 AAGGATGAGGAGAAAGGGACAGG + Intronic
962500013 3:135981763-135981785 GAGAGTAATGAGAAGGGGCCAGG + Intronic
962685411 3:137842945-137842967 GACAACAAGGAGAATGGCAGAGG - Intergenic
963380543 3:144524484-144524506 GAGAATAAGAGGAATGGCTCAGG + Intergenic
963711743 3:148754791-148754813 GAGAATAAAGGAAACGGGACTGG + Intergenic
964060621 3:152517953-152517975 GAGAATACAGAGAATGGATCTGG + Intergenic
964281582 3:155072235-155072257 GGGAATGAGGAGGATGGGAAAGG - Intronic
964779140 3:160315718-160315740 GGGAATATGGAGAGTGGGAGGGG + Intronic
964950024 3:162279196-162279218 GAAAATGAGTAGAAAGGGACAGG + Intergenic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
965983432 3:174722102-174722124 GTAAATAAGAAGAATGGGAAAGG - Intronic
967516335 3:190373151-190373173 AAGTATAAGGAGAAAGGGAAGGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
969086491 4:4660378-4660400 GAGACTAATGAAAATGGGAGTGG - Intergenic
969873978 4:10122538-10122560 GAGTTTAAGAAGAATGGGACAGG - Intergenic
969890251 4:10253505-10253527 GGGAATATGGAGAAAGGGAGAGG + Intergenic
969968629 4:11022899-11022921 GAGACAAAGGAGAGTGGGAATGG - Intergenic
970094817 4:12451315-12451337 GAATATAAGTAGAATGGGCCAGG - Intergenic
970174476 4:13325150-13325172 AAGGATAAGGAGGATTGGACAGG - Intergenic
970630173 4:17933529-17933551 GATAAAAAGGAAAATGGGAATGG - Intronic
970903312 4:21185482-21185504 GAGAAAAAGGAGAAGAGGAGGGG - Intronic
971021598 4:22542289-22542311 GAGAAAAATGAGGATGGGACAGG - Intergenic
971888493 4:32484286-32484308 GAGAATAACTAGAGTGGGCCAGG - Intergenic
972027285 4:34398783-34398805 GAGTAGAAGGAGGAAGGGACAGG + Intergenic
972381714 4:38525657-38525679 GAGAATAATCTGAATGGTACTGG + Intergenic
972634082 4:40867509-40867531 GACAATTTGGAGAATGAGACAGG - Intronic
973008063 4:45037949-45037971 GAGAATAAGGAAAAAGAGATGGG - Intergenic
973632189 4:52829967-52829989 GAGAAAAAGGAGAAAGGAAGAGG - Intergenic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976402511 4:84623432-84623454 GAAACTAAGGAGAAAGGGCCCGG - Intronic
976602041 4:86946677-86946699 AAGAATAAAGAGAGTGGGCCGGG - Intronic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
977094487 4:92722436-92722458 GAGAATGAGGAAAAGGGGAACGG + Intronic
977126247 4:93172295-93172317 GAAAATAATGAGAATTGGCCAGG + Intronic
977875732 4:102147851-102147873 GAAAACAAGGAGGATGGGATGGG + Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
978602624 4:110444579-110444601 GGCAATAAAGAGAATGGGGCTGG - Intronic
979827733 4:125260014-125260036 GAAAAGAAGGAGAATGGAACAGG - Intergenic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
980028391 4:127794228-127794250 GAGAGTGAGGAAAATAGGACAGG + Intronic
980062476 4:128146631-128146653 GAGAAGGAGGGGAATGGGATTGG + Intronic
980272489 4:130604286-130604308 GAGATTAAGGAAATTGGGAAAGG - Intergenic
981172724 4:141643569-141643591 GAAAATAAGGAGAAGGGGAGTGG - Intronic
981193165 4:141887049-141887071 CAGGATAGGGTGAATGGGACTGG + Intergenic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981567529 4:146116268-146116290 GAGGATAAAGAGAAAGGGAGTGG + Intergenic
981966968 4:150615605-150615627 GAGAAAAAAGAGAATGTGAGAGG + Intronic
982373983 4:154667310-154667332 GAGGAGGAGGAGAATGGGAGGGG + Intronic
984677162 4:182563018-182563040 CAGAATATGGAGAAAGGTACAGG + Intronic
984725162 4:183013450-183013472 AAGAAGAAGGAGAAGGGGAAGGG - Intergenic
984982591 4:185297407-185297429 GAGATTAAGTAGAAAGGTACAGG - Intronic
985219036 4:187683051-187683073 GAGAATGAGGAGGGTGGGAAGGG + Intergenic
985365513 4:189227490-189227512 AAGACTAAAGAGAATGGGAGAGG - Intergenic
986944621 5:13000860-13000882 GAGGATGAGGAGATTGGGAAAGG + Intergenic
987774401 5:22345805-22345827 GTCAAAAAGGAGAATGGGTCCGG + Intronic
988911811 5:35851122-35851144 GACAAAAAGGAGAAAGTGACGGG - Intergenic
989157155 5:38355107-38355129 GAGAGTGGGGAGAATGAGACAGG + Intronic
989433352 5:41381486-41381508 GAGAAAAAGGAGACAGAGACTGG + Intronic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
991262893 5:64685943-64685965 GGGAATAAGGACAATAAGACTGG + Intergenic
991612722 5:68465632-68465654 GAGAATAAGGAGAAAAGGAAAGG - Intergenic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
992056795 5:72998141-72998163 GAATGTAAGGGGAATGGGACAGG + Intronic
992203964 5:74411872-74411894 AAGCATAAGGAGATTGGGTCAGG + Intergenic
993720372 5:91315882-91315904 GAGAAGAAGGGGAAAGGGAAGGG + Intergenic
993905427 5:93618364-93618386 TAGAACAAGTAGAATGGGAAAGG - Exonic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994776543 5:104041806-104041828 GAGTATAAAGAGACTGGAACTGG + Intergenic
995609602 5:113895166-113895188 GAAAAAAAGGGGAATGGGAATGG - Intergenic
995788762 5:115860726-115860748 AAGGATGAGGAGAATGGGAAAGG - Intronic
995984097 5:118147194-118147216 GAGGAAAAGGAGAATTGGAAAGG - Intergenic
996235154 5:121118958-121118980 GAGAAAAAGGAGAACAGTACAGG + Intergenic
996457670 5:123703405-123703427 GAGTGTGAGGAGAATGGGAGTGG + Intergenic
997465702 5:134086701-134086723 GAAAAGAAGGAGAAGGGGAAGGG - Intergenic
997715689 5:136040944-136040966 GAGTATAAGGAGAGTGGAGCAGG + Intronic
998857572 5:146408322-146408344 GAGAATAAGAGGAGTGGGGCTGG - Intergenic
999706340 5:154275774-154275796 GAGAACAAGGAAAATGTGCCTGG + Intronic
1000073002 5:157758400-157758422 GATAATAAAGAAAAGGGGACCGG - Exonic
1000267494 5:159651683-159651705 GAGAATATAGAAAATGAGACAGG - Intergenic
1001148495 5:169205340-169205362 CAGAATAAGGAGAATAGAATAGG - Intronic
1001350687 5:170960807-170960829 GAAAATGAGGCTAATGGGACAGG - Intronic
1001383392 5:171318407-171318429 GAGACTAAGAAGAAGGGGAGGGG + Intergenic
1002968485 6:1991074-1991096 GAGAATAAGAGGAATAGGAAGGG - Intronic
1004666412 6:17752177-17752199 GAGAATCAGGAGGTTGAGACTGG + Intergenic
1005765265 6:29005267-29005289 AAGAATAAAAAGAATGGGTCAGG + Intronic
1006372172 6:33651952-33651974 GAGAAAAGGCAGAAAGGGACAGG - Intronic
1008691225 6:53981548-53981570 GGGAATAAGGATTATGGGATAGG + Intronic
1009957002 6:70467694-70467716 GAAAAGAAGGAGAAAGGGAGTGG - Intronic
1010004978 6:70986013-70986035 GAGAACAAGGGGAATAGAACTGG - Intergenic
1010694412 6:78952494-78952516 GAGAATAGACAGAATGGGAGAGG - Intronic
1010873171 6:81066777-81066799 GAGAATAAAGAGGAAAGGACAGG - Intergenic
1012109075 6:95203317-95203339 GAGAATAGAGAGAATGGTACAGG + Intergenic
1012137667 6:95578422-95578444 GAAAATAAGAAAAATGGGACTGG + Intronic
1013491494 6:110650735-110650757 AAGACTAAGGAGAATAGAACGGG + Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015846497 6:137525577-137525599 GAGAAACAGGAGGATGGGAGAGG + Intergenic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1017037117 6:150276653-150276675 GAGAAAAAGGAGAAAGGAAACGG - Intergenic
1017504039 6:155051211-155051233 GAGAATAAGAAGAATGGAGATGG + Intronic
1017629008 6:156377958-156377980 GAGAATCTGCAGAATGGGATAGG - Intergenic
1017833717 6:158156515-158156537 GACAATAAAGAGAATGGAACAGG + Intronic
1017847674 6:158273603-158273625 GAGCTGAAGAAGAATGGGACAGG - Intronic
1018362639 6:163087368-163087390 GTGAAAATGGAGACTGGGACTGG + Intronic
1020369271 7:7414646-7414668 GAGAATCAAGAGAATAGGAAGGG + Intronic
1020381183 7:7548358-7548380 GAGAGAAAGGGGAATAGGACTGG + Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021289380 7:18823989-18824011 AAGAAGAAGGAGAAGGGGAATGG + Intronic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1022514719 7:30968306-30968328 GAGAGCAAGGAGAATGACACAGG + Intronic
1022790735 7:33686557-33686579 TAGAAACAGGAGAATGGGCCTGG + Intergenic
1023085770 7:36568737-36568759 GAGAAGAAAGAGAAGGGGAGGGG - Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023236611 7:38097021-38097043 GAGAATTTGGAGAATGGCAATGG - Intergenic
1023605819 7:41929787-41929809 GTCAACAAGGAGAATGGGAGAGG + Intergenic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024526290 7:50352568-50352590 AAGAATAATGTCAATGGGACGGG + Intronic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025622536 7:63187051-63187073 GGCAATAAAGAGAATGGGGCTGG - Intergenic
1026009269 7:66624236-66624258 GAGAATATGCAGAATGGGAAAGG - Intergenic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1028120276 7:87049747-87049769 AAGAACAAGTAGACTGGGACTGG + Intronic
1028636298 7:92993434-92993456 GAGAACAAGAAGAAAGGGAGGGG + Intergenic
1028746829 7:94336895-94336917 GAGAACAAGGAGAATGTAGCAGG - Intergenic
1028775342 7:94669765-94669787 GAGAGTAGGGAGAGTGGGAGAGG + Intergenic
1029974426 7:104819524-104819546 GAGAAGAAGGGGAAAGGCACAGG - Intronic
1030245111 7:107376627-107376649 GAGATAGAGGAGAATGGGAAGGG - Intronic
1031018589 7:116602108-116602130 GAGAGTAAGGAAAGTGGGAGGGG + Intergenic
1031214842 7:118877207-118877229 GGGAAGAAGGAGAAGGGGAGGGG + Intergenic
1031908329 7:127486648-127486670 GGGAATAAGGAAAATGGAATAGG + Intergenic
1034063290 7:148112738-148112760 GAGAATATAGAGAAAGGGGCTGG + Intronic
1034994994 7:155571545-155571567 GAGGAGAAGGAGAGTGGGATAGG - Intergenic
1036145150 8:6248111-6248133 GAAAATAAGGGAAAAGGGACTGG + Intergenic
1037225486 8:16584628-16584650 GAAAATAAGGAGAAACGGCCAGG + Intergenic
1037590815 8:20310612-20310634 GAGATTAAGGAGGGTGGGTCAGG - Intergenic
1037898026 8:22671157-22671179 GGGAAATAGGAGAATGGGAAAGG + Intergenic
1037908105 8:22727338-22727360 GAGAAGAAGTAGGATGGGAGAGG + Intronic
1037929958 8:22873116-22873138 GAGTATAAAGAGAAAGGGGCTGG + Intronic
1037951017 8:23018863-23018885 GAGAAGAGGGAGAATGGAGCAGG + Intronic
1038120391 8:24607973-24607995 GAGGAAAAGGAGAAGGGGAGGGG + Intergenic
1038135367 8:24780038-24780060 GAGACTAATGAGAGTGAGACAGG + Intergenic
1039799424 8:40941546-40941568 GAGAATCAGGAGAATGAACCTGG - Intergenic
1039957287 8:42217404-42217426 GAGAGGAAGGAGAATCGAACAGG + Intergenic
1041055304 8:53979644-53979666 GAGGATTAGGATTATGGGACAGG + Intronic
1041362334 8:57066746-57066768 AAGAATGACGAGAATGGGGCTGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1042614502 8:70633590-70633612 GAGAATAGAGGAAATGGGACAGG - Intronic
1042774757 8:72418386-72418408 GAGAATATGGCAAATGTGACAGG + Intergenic
1043336567 8:79183322-79183344 GAGGAAAAGTAGAATGGGAAGGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1046348036 8:112962793-112962815 GAGAATAGGGAGAATGGACCTGG - Intronic
1046465398 8:114595788-114595810 GGGATGAAGGAGAATGGGATTGG - Intergenic
1046611530 8:116430907-116430929 GAGAACAAGGTGAATGTGAGTGG - Intergenic
1046814596 8:118570353-118570375 GAGAGTATGGAGGATGGGAGGGG - Intronic
1046918519 8:119702722-119702744 GAGAAGAAGAAGAAAGGGAAAGG - Intergenic
1047027886 8:120844534-120844556 GAAAAAAAGGGGAGTGGGACAGG - Intergenic
1047039230 8:120974296-120974318 GGAAAAAAGGAGAATGGGCCAGG + Intergenic
1047101342 8:121679461-121679483 AGGGATTAGGAGAATGGGACAGG + Intergenic
1047174552 8:122528134-122528156 GAGAGTAAGGAGAATGAGCTGGG + Intergenic
1048417559 8:134243633-134243655 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048417576 8:134243693-134243715 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048516562 8:135116765-135116787 GAGAAGAAGGAGAAAGGAGCCGG - Intergenic
1049031059 8:140038167-140038189 GAGAATAAAAAGGATGGCACAGG + Intronic
1050358547 9:4805390-4805412 AAGAAGAAGGAGAAGGGGAAGGG + Intronic
1050624399 9:7487634-7487656 GAGAAGGTGGAGAATGAGACTGG + Intergenic
1050885609 9:10761507-10761529 GATATTTAGGAGAATGGGACTGG - Intergenic
1052081933 9:24216894-24216916 GTGAGTAAGGAGAATGGGTCAGG + Intergenic
1052976791 9:34417057-34417079 AAGAAGAAGGAGAAGGGGAAGGG - Intronic
1053043491 9:34894077-34894099 GGGAATAAAGAGAATAAGACAGG + Intergenic
1053167060 9:35852489-35852511 GAGCATGAGGAGACAGGGACAGG + Intronic
1055215047 9:73849322-73849344 GAGAAGTAGGCGAATGGGATAGG + Intergenic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1056335590 9:85565551-85565573 GACAATAAAGAGAAAAGGACAGG + Intronic
1056365611 9:85901478-85901500 GAGAAAAAGGAGCATAGAACAGG + Intergenic
1056439080 9:86602590-86602612 GAGCTGAAGGAGCATGGGACTGG + Intergenic
1057181525 9:93033294-93033316 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181534 9:93033317-93033339 GAGGAGGAGGAGAAGGGGACGGG - Intronic
1057181543 9:93033340-93033362 GAGGAAGAGGAGAAGGGGACGGG - Intronic
1057641822 9:96831102-96831124 GAGAAAAGGGAGAAAGGGAGGGG + Intronic
1057910985 9:99020593-99020615 GAGAATCAGGAAAAGGGCACTGG + Intronic
1058088210 9:100774031-100774053 GAGATGAAGGAGAAAGGGAAAGG - Intergenic
1059000215 9:110340896-110340918 AAGAAAAAGGAGAATGGAAATGG - Intergenic
1059067117 9:111096997-111097019 GAGAAAAAGGAGAGTGGGTAAGG + Intergenic
1059250430 9:112883159-112883181 GAGAAGAAAGTGAATGGGAGTGG + Intronic
1059542524 9:115144377-115144399 GAGGAAAAGGAGAAGGGGAGGGG - Intronic
1059730552 9:117052909-117052931 GAGAATAACCAGGATTGGACTGG + Intronic
1059840812 9:118213616-118213638 AAGGAAATGGAGAATGGGACCGG - Intergenic
1060693565 9:125686553-125686575 GAGGAAAAGGAGGATGTGACTGG + Intronic
1062624818 9:137438002-137438024 GCGAACAAGGAGAATGGCACGGG - Exonic
1203612376 Un_KI270749v1:21386-21408 GAGAAGCAGGAGCATGGGAGGGG - Intergenic
1185725775 X:2420446-2420468 TAAAATAAAGAGAATGGGGCCGG + Intronic
1186039934 X:5464512-5464534 GAGAAAAAGAAGAAAGGGAATGG + Intergenic
1186139783 X:6559420-6559442 TAGAATAAGGAGAGTGTGAAGGG + Intergenic
1187034428 X:15522821-15522843 GAGAAGGAGGAGAAAGGGAAGGG - Intronic
1187296506 X:18006644-18006666 GAGAAAAAGTAGAATAGGAAAGG + Intergenic
1187363710 X:18650052-18650074 AAGAATAAGGTGACTGGGAGAGG - Intronic
1187412393 X:19062577-19062599 GAGAATGAGGAGACCAGGACAGG + Intronic
1187596855 X:20782812-20782834 GAAAATAAGCAGAGTGGGAGAGG + Intergenic
1188817086 X:34728931-34728953 GAGAATAAGGAGAGTGCCATTGG + Intergenic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189232106 X:39460608-39460630 GACAGGAAGGAGAATGAGACTGG - Intergenic
1190186601 X:48240056-48240078 GAGAATAGAAAGAATGGGCCTGG - Intronic
1190668198 X:52714883-52714905 GAGAATAGAAAGACTGGGACGGG + Intergenic
1190671219 X:52743521-52743543 GAGAATAGAAAGACTGGGACGGG - Intergenic
1190937327 X:55008585-55008607 GAAAAGAAAAAGAATGGGACTGG + Exonic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193736052 X:85157880-85157902 AAGAATATGTAGATTGGGACAGG - Intergenic
1194128771 X:90053305-90053327 CAGAAGGGGGAGAATGGGACGGG + Intergenic
1194142583 X:90223114-90223136 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1195002250 X:100653118-100653140 GACAATAGAGAGAATGAGACTGG + Intronic
1195449272 X:104991952-104991974 AAAAATAAGGAGATTTGGACAGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195822910 X:108966603-108966625 GATAAGAAGGAGAATTGAACAGG - Intergenic
1196727060 X:118905263-118905285 GAGAAGAAGAAGAAGGGGAAGGG - Intergenic
1196903332 X:120408514-120408536 TAGAAACAGGAGCATGGGACTGG + Intergenic
1197314127 X:124942920-124942942 GAGACTAAGGAGGATCAGACAGG + Intronic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198864467 X:141106599-141106621 GGAAATAAGGGGATTGGGACAGG + Intergenic
1198898224 X:141480808-141480830 GGAAATAAGGGGATTGGGACAGG - Intergenic
1198993805 X:142548902-142548924 GAGAAAAAGGAGACTGAGAATGG - Intergenic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199735578 X:150683146-150683168 GATAATAAGGAAACTGGGACGGG + Intergenic
1200488337 Y:3792215-3792237 GAGAATAAGGCGAATGGGGCTGG + Intergenic
1201011397 Y:9550458-9550480 GAGAATACTGGGAATGGGGCAGG + Intergenic
1201014020 Y:9579787-9579809 GGAAATAAGGAGAGTGAGACAGG + Intergenic
1201313695 Y:12621727-12621749 GGGACCAAGGTGAATGGGACTGG - Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1202168873 Y:22020040-22020062 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202222488 Y:22566328-22566350 GGGAATCAGGAGAATGGGCCTGG + Intergenic
1202320627 Y:23629332-23629354 GGGAATCAGGAGAATGGGCCTGG - Intergenic
1202550140 Y:26040724-26040746 GGGAATCAGGAGAATGGGCCTGG + Intergenic