ID: 1199093733

View in Genome Browser
Species Human (GRCh38)
Location X:143717651-143717673
Sequence AGTTTTTAAAAGCTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 5, 2: 5, 3: 50, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199093733_1199093741 26 Left 1199093733 X:143717651-143717673 CCCTACTCCAGCTTTTAAAAACT 0: 1
1: 5
2: 5
3: 50
4: 408
Right 1199093741 X:143717700-143717722 CCATCTCAGAGATATTACTAAGG 0: 1
1: 1
2: 6
3: 12
4: 169
1199093733_1199093736 -1 Left 1199093733 X:143717651-143717673 CCCTACTCCAGCTTTTAAAAACT 0: 1
1: 5
2: 5
3: 50
4: 408
Right 1199093736 X:143717673-143717695 TTCTAGACATTCTTCCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199093733 Original CRISPR AGTTTTTAAAAGCTGGAGTA GGG (reversed) Intronic
901244573 1:7719567-7719589 AGTTTTCAAAAAGTGGAGTATGG + Intronic
905325640 1:37149910-37149932 ATTTTTTAAAAGCAGGACTGAGG - Intergenic
907348080 1:53800858-53800880 ACATTTTAAAAGCTGGTGTTTGG - Intronic
907646421 1:56248718-56248740 AATTTCTAAAAGCAAGAGTAAGG + Intergenic
907677970 1:56536343-56536365 AGTTTCTTAAAGGTGGACTAAGG - Intronic
907933082 1:59018256-59018278 AGTCCTTAAAAGGTGGAGGAAGG + Intergenic
908782150 1:67700500-67700522 AGTTTTTAAAAGATGGGGGAAGG - Intergenic
909142584 1:71887660-71887682 AGTTTTAAAAAGCTGGAAGGAGG - Intronic
909799086 1:79782838-79782860 AGTTTGTACAACCTGGAGCATGG + Intergenic
910477045 1:87618634-87618656 ATTTTTTTAAAGGTGGAGTTAGG + Intergenic
910655566 1:89614850-89614872 AATTTTTAAAAGGCGGAGCAGGG - Intergenic
910696777 1:90026886-90026908 ACTTTTTAAAAGTAGAAGTAAGG + Intronic
911151761 1:94602981-94603003 GATTTTTAAAAGCTGGATTGGGG + Intergenic
911326629 1:96475790-96475812 AGTTTTTAGGAGCTGGTGTGGGG - Intergenic
913456875 1:119041499-119041521 AGTTTTTAAAATATGATGTAGGG - Intronic
915234707 1:154472203-154472225 AGTTTTTAAATGATGGAGAGAGG + Intronic
916851173 1:168705534-168705556 TTTTTTAAAAAGCTGAAGTATGG - Intronic
917165122 1:172103340-172103362 AATGTCTAAAAGCTGGTGTATGG + Intronic
917196567 1:172472491-172472513 TGTTTTTAAAAGCTACAGCACGG - Intergenic
917391087 1:174537934-174537956 CATTTTTAAAAGGTGGACTAAGG - Intronic
917937777 1:179885454-179885476 TATTTTAAAAAGCTGGAGAAGGG + Intronic
918051184 1:180973898-180973920 AGTTCTTTAAAACTGGAATATGG + Exonic
918516743 1:185371385-185371407 ACTTTTTAAAAGTTGAAGCATGG + Intergenic
918573521 1:186027116-186027138 TGTTTCTCAAAGCTGTAGTAAGG + Intronic
918702696 1:187625322-187625344 AGTTTTTAAGAGCTAGGGTAGGG - Intergenic
918739470 1:188108790-188108812 AGTTTCCAAAGGCTGGAATAAGG - Intergenic
918882008 1:190136948-190136970 CTTATTTAAAAGCTGGGGTATGG + Intronic
919964862 1:202512797-202512819 TGTTTTTAAAAAGTGGAGTAGGG - Intronic
920281760 1:204848866-204848888 ACTTATTAACAGCTGGGGTAGGG - Intronic
920703616 1:208235996-208236018 AGTTTTAAGCAGCTGGAGTCAGG + Intronic
921139723 1:212295694-212295716 AGTCTTTAAAAACTGGGGGATGG + Intronic
921630446 1:217426600-217426622 AATTTTTCAAGGCTGAAGTAAGG - Intergenic
922881205 1:228982479-228982501 AGTTTTTAAAGTCTGCCGTAGGG + Intergenic
923165298 1:231355841-231355863 AGTGTTTAACAGATGTAGTAAGG - Intergenic
923276107 1:232397783-232397805 AGTTTTTAATAGCTGCTGTGTGG - Intergenic
923696737 1:236260275-236260297 AGCCTACAAAAGCTGGAGTAAGG + Intronic
924654536 1:245961629-245961651 TGTTTTTAAGAGCTGGAGTGGGG - Intronic
1063347280 10:5323927-5323949 GGTTTTCTAAAGCTGGTGTATGG - Intergenic
1064449719 10:15430803-15430825 AGTGTTTAAAAGCAGGGGTTTGG - Intergenic
1064498983 10:15947978-15948000 AATTTTTAAAATCTGGGTTATGG + Intergenic
1064585049 10:16831758-16831780 AATTTTTAAAAGGTGGAGATGGG + Intronic
1064863486 10:19853119-19853141 AGTTTTAAAAGGCTGAAGGAAGG + Intronic
1065359585 10:24877034-24877056 GGTTTTTAGAAGGTGGAGTAAGG - Intronic
1065653970 10:27927063-27927085 AGTTTTTAAAAGAAGTAGTCTGG + Intronic
1065771866 10:29085422-29085444 ATCTTTCATAAGCTGGAGTATGG - Intergenic
1065798739 10:29331753-29331775 AGTTTTTAAACACTGTGGTAGGG - Intergenic
1065823985 10:29552993-29553015 ACTTTTTAAGAGGTGGAGTCTGG + Intronic
1066135520 10:32441825-32441847 AGTTTGCAAAAGCTGCAGCAGGG - Intergenic
1067823959 10:49556164-49556186 AGTCTTTATAACCTGGAGTTTGG + Intergenic
1067963393 10:50881635-50881657 AGTTTTTAATTGCTGGAGGGAGG + Intronic
1068092470 10:52449777-52449799 AGTTGTGAAAAGCTGGAAAAAGG - Intergenic
1068401634 10:56535249-56535271 AGTTTTTAAAAGCTAGGGTCAGG + Intergenic
1068447648 10:57143490-57143512 AGTTTTTGAAAGCTGGGGTCAGG - Intergenic
1068838894 10:61588271-61588293 AGTTTTTAAAATTTGGATTGTGG - Intergenic
1069195542 10:65546294-65546316 AGTTATTAAGAGCTGGACTGGGG - Intergenic
1070691016 10:78525572-78525594 ACTTTTTAACTGGTGGAGTAAGG - Intergenic
1071217198 10:83420606-83420628 AGTTTTCAAAACCTGGTGTTTGG + Intergenic
1071579743 10:86757458-86757480 AGTTTTCCAAAACTGAAGTACGG - Intronic
1071931073 10:90470954-90470976 ATTTTTTAAAAGCAGGAATGAGG + Intergenic
1072133712 10:92522698-92522720 AGCTTTTAAGTGCTGGAGTCAGG - Intronic
1072808512 10:98442473-98442495 ATTTTTTAATAGCTGTATTAAGG - Intronic
1073630831 10:105147216-105147238 TGTTTTTAAATTCTGTAGTATGG - Intronic
1073798043 10:107010224-107010246 ACTTTCTAAAGGATGGAGTAGGG + Intronic
1073815741 10:107204798-107204820 GATTTTAAAAAGCAGGAGTAGGG - Intergenic
1075814522 10:125254613-125254635 AGGTTTTAGAAGCTTCAGTAAGG - Intergenic
1076251080 10:128984359-128984381 AGTTTTGAGAAGCTGCTGTAAGG - Intergenic
1077872910 11:6278595-6278617 ATTTTTTAAGTGGTGGAGTAAGG + Intergenic
1078271302 11:9797560-9797582 AGTTCTACAAACCTGGAGTATGG - Intronic
1080075041 11:28139049-28139071 AGTTCTTAACAGCTGGACTTCGG - Intronic
1081218616 11:40433202-40433224 TGTATTTAAAAGCTGGATTGTGG + Intronic
1081386313 11:42477728-42477750 CATTTTTCAAAGCTGGTGTAAGG - Intergenic
1081824300 11:46033163-46033185 ATTTTTTAAAAACTATAGTATGG + Intronic
1082377674 11:51894390-51894412 AGTGTTTGAAAGCTGTACTATGG - Intergenic
1082546868 11:54342559-54342581 AGTGTTTGAAAGCTGAACTATGG - Intergenic
1082549879 11:54382480-54382502 AGTGTTTGAAAGCTGAACTATGG - Intergenic
1082550794 11:54394766-54394788 AGTGTTTGAAAGCTGAACTATGG - Intergenic
1082552028 11:54411149-54411171 AGTGTTTGAAAGCTGAACTATGG - Intergenic
1085149201 11:74234796-74234818 TGTTTTTAAAGGCTGGATAATGG + Intronic
1085293499 11:75417290-75417312 ATTTTTTAAGAGATGGAGTCTGG - Intronic
1086014312 11:82147840-82147862 AGTATTTAAAAATTGGATTATGG + Intergenic
1086017888 11:82189345-82189367 ATTTTTTAAAAACTGGAATTTGG - Intergenic
1086208267 11:84286271-84286293 AGTTTTTAAAAGCAGCAGAGTGG - Intronic
1086225162 11:84499117-84499139 AGTGGTTAAGAGCTGAAGTAGGG + Intronic
1086747371 11:90446465-90446487 AGTTTTTACAACTTGGAGCAAGG + Intergenic
1087386715 11:97480495-97480517 AGTTATTAGAGGCTGGGGTAGGG + Intergenic
1087606070 11:100379875-100379897 AGTTATCAAATGCTGGAGTCAGG + Intergenic
1088047905 11:105475736-105475758 ATTTTTTAAAATCTGTAATAGGG + Intergenic
1088998725 11:115030186-115030208 ATTTTTTAAAAGGTGGAGGATGG + Intergenic
1090051047 11:123380011-123380033 ATTTTTTTAAAGCTGGAGAAAGG - Intergenic
1090565278 11:127984637-127984659 AATTTTAAAAAGCTGGCGAAGGG - Intergenic
1093934249 12:24984033-24984055 AGGTATTGAAAACTGGAGTAAGG - Intergenic
1093943562 12:25082296-25082318 ATTTTTTAAAAACTAAAGTAAGG + Intronic
1094072803 12:26437207-26437229 AGTTTTTAAAAGTTAGAGAATGG - Intronic
1094295547 12:28900848-28900870 ACTTATTGAAAACTGGAGTAAGG + Intergenic
1095529665 12:43171812-43171834 AGTTTTTAATAGCTTTATTAGGG + Intergenic
1096009387 12:48200129-48200151 AGTTTTTAAGAGCTGCTGTACGG - Intergenic
1097354197 12:58583358-58583380 AGTTTTTGGAAGCTGGAGGGAGG + Intronic
1097471140 12:59993654-59993676 AGTTTTTAAGAGCTGAGGTTGGG + Intergenic
1097484728 12:60181761-60181783 CCTTTTTAAAGGTTGGAGTATGG - Intergenic
1097786588 12:63766727-63766749 AGTTTTTAAAAACTGCATTTTGG + Intergenic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098325389 12:69297085-69297107 AGTTTTTAAGGGCTGGAGGTTGG + Intergenic
1099122442 12:78708451-78708473 AATTTTTAAGCTCTGGAGTACGG + Intergenic
1099529545 12:83760969-83760991 AGTCTTTAAAAGCTGTGGTGAGG + Intergenic
1099934238 12:89106763-89106785 AGTTTTTAAGATCCAGAGTAAGG + Intergenic
1100032826 12:90214091-90214113 ACTTGATAAAAGCAGGAGTAGGG - Intergenic
1100603145 12:96129592-96129614 AGTTTTTTAAAGCTGCACAAGGG - Intergenic
1101447780 12:104749862-104749884 GGTTTATGAAACCTGGAGTAAGG - Intronic
1101767942 12:107720481-107720503 ATTTTTTAAATGCTGGGGTGGGG - Intergenic
1101832204 12:108267528-108267550 AGTGGTTAAGAGCTGGAGTCTGG - Intergenic
1102553028 12:113705930-113705952 ATTTAATAAAAGCTGGAGTGAGG + Intergenic
1102699876 12:114829831-114829853 AGTTTTTAGAATCTGGAGACAGG + Intergenic
1102855998 12:116294358-116294380 AGTCTTTATAAGCTGAAGAAGGG - Intergenic
1105395305 13:20027827-20027849 AGTTTTTCAAATTTGGAGTATGG + Intronic
1105565250 13:21539178-21539200 TGTTTTTAAAACATGAAGTAAGG - Intronic
1106967388 13:35087928-35087950 AGTTTTCTATAGCTGGAGTTTGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107191218 13:37588976-37588998 AGTTTTTAAGAATTGGAGAAAGG + Intronic
1108111687 13:47080691-47080713 AGTTTCTAAAAGCTGAAGGCAGG + Intergenic
1108682883 13:52794431-52794453 AGTGTCTGAAAGCTGGAGAAGGG - Intergenic
1108870371 13:54977052-54977074 AGTTATTAAAAGCTCAAGGAAGG + Intergenic
1109038206 13:57294117-57294139 AGTTATTAGAAACAGGAGTATGG + Intergenic
1109387990 13:61657613-61657635 AGATTTTAAAAAGTGGAGTTGGG - Intergenic
1109622897 13:64931812-64931834 AGTTTTTAAGAGCTGAGGTGGGG - Intergenic
1109779133 13:67084490-67084512 GGTTTTTAAAGGAAGGAGTATGG - Intronic
1110384546 13:74893558-74893580 CGTTTTTAAAACTTGAAGTAAGG - Intergenic
1110494522 13:76150649-76150671 AGTTTTTAAATGATGGAGTCAGG + Intergenic
1111147247 13:84199275-84199297 ATTATTTAAAAGGTGGAGTCTGG + Intergenic
1111488119 13:88931315-88931337 AGCTTCTAAAAGCAGGAGTCAGG - Intergenic
1111515359 13:89324249-89324271 AATTTTTAAAAGCTGGTATGAGG + Intergenic
1111607777 13:90563308-90563330 AGATTTTAAGAGCTGGTGTGGGG + Intergenic
1111620658 13:90721166-90721188 AATTTTTAAAATCTGTAATAGGG - Intergenic
1112098949 13:96166216-96166238 AGTTTTTAAGAGCTGGAATGGGG + Intronic
1113030507 13:105989006-105989028 AGTTTATAAAGCCTGCAGTAGGG - Intergenic
1114240909 14:20867086-20867108 CGTTTTTGAAATCTGGAGGAAGG - Intergenic
1114529533 14:23387283-23387305 AGGTTTTAAAAGTTGGAATCTGG - Intronic
1114541791 14:23466196-23466218 AGTTTTTAAAACCTGCATTAGGG - Intergenic
1114556237 14:23563953-23563975 AGTTTAGAGCAGCTGGAGTAAGG - Intronic
1114591503 14:23869191-23869213 AGTTTTTAAGAGATGGGGTAGGG + Intergenic
1114711959 14:24787709-24787731 AGTTTTTCCAAGCAGGAGTGAGG - Intergenic
1114885863 14:26850353-26850375 AGTCTTTAAAAGCAAGAGTTGGG + Intergenic
1115218869 14:31039483-31039505 TGTTTTTAAAAGCTACATTAGGG - Intronic
1115907278 14:38213898-38213920 TATTTTTAAAAGCTGCAGCAAGG + Intergenic
1116368190 14:44096004-44096026 AGTTTGCAATAGCTGGAGGAAGG - Intergenic
1116647009 14:47541045-47541067 ATTTTTTGAAATCTGAAGTAAGG - Intronic
1117262186 14:54047248-54047270 AATTTTTAAGATCTGGAGAAAGG - Intergenic
1117405619 14:55400318-55400340 AGTTTTTAAAAGTGTGTGTAGGG + Intronic
1118613094 14:67556576-67556598 AGTATTTAAAAGCTGGTGCAGGG - Intronic
1119224839 14:72937177-72937199 TGTTTTTAAAAGCTGAGATAAGG + Intronic
1119581191 14:75782910-75782932 CCTTTCTAAAAGCTGGAGTTGGG - Intronic
1119952198 14:78756633-78756655 AATTTTTAAAAGTTGGAGCAAGG - Intronic
1120189361 14:81426406-81426428 GGTATTTAACAGCTGGAGAAGGG - Intronic
1120828515 14:88976996-88977018 AGTATTCAAAAGCTGGAACATGG - Intergenic
1121088813 14:91167262-91167284 ATCTTTCAAAAGCTGGAGCAAGG - Exonic
1122050162 14:99053353-99053375 GGTATTCAAGAGCTGGAGTAGGG - Intergenic
1122296892 14:100710946-100710968 AGCTTTAAAAAGCTGCAGTGCGG - Intergenic
1125295205 15:38195335-38195357 AGTTTCTAAATGCTGGACTGTGG + Intergenic
1125959701 15:43819311-43819333 ATTTTTTAAAAGGTAGAGAAAGG + Intronic
1126053638 15:44709935-44709957 AGTTTTTAAAAGGGGGAAAAGGG + Intronic
1126229720 15:46310605-46310627 AGATTTTAGAAGATGAAGTAAGG + Intergenic
1127765355 15:62180770-62180792 AGTTTCTAATAGCTAGAGGAAGG + Intergenic
1127922086 15:63502463-63502485 TGTTTTTAAAAGCCGGTGTTGGG + Intergenic
1127991722 15:64123846-64123868 AGATTTTAAAAGATGGTTTAGGG - Intronic
1131163389 15:90124761-90124783 GGTGTTTAAAAGCTGTAGTCAGG + Intergenic
1131662551 15:94533698-94533720 AGTTTTTTAAAGTTGCAATATGG - Intergenic
1132169818 15:99638552-99638574 AATTTTAAAAAGCAGGAGAAAGG - Intronic
1132379193 15:101354637-101354659 AGTTTTTAAAAGCACATGTATGG - Intronic
1132535373 16:476609-476631 ACTTTTTAAAAGCTGGTCCAAGG + Intronic
1135043779 16:19137738-19137760 AGTATTTAAAAGCTGAACAAAGG - Intronic
1135248999 16:20884346-20884368 AGTTTTGCAAAGCTAGAGTGGGG - Intronic
1137622133 16:49883101-49883123 AGTGTGTAAAAGCTGGAAAAGGG - Intergenic
1138020909 16:53480487-53480509 ATTTTTTAAAAGTAGGAGAAAGG - Intronic
1139498635 16:67341800-67341822 TCTTTTTAAAAGCAGCAGTATGG - Intronic
1140597484 16:76433783-76433805 AACTGCTAAAAGCTGGAGTAAGG + Intronic
1140647426 16:77048296-77048318 AGTTTTTAAAGGCTTAAGCAGGG - Intergenic
1143264199 17:5623548-5623570 AGTTTTGAAAAGATTGATTAGGG + Intergenic
1144363851 17:14522972-14522994 AGATTCTAAAAGCTGGATTAGGG - Intergenic
1146083416 17:29804536-29804558 ACTTTTTAAAAAGTGGAATAAGG - Intronic
1146540048 17:33686130-33686152 AGTTCTTAACAGCTGCAGCAGGG + Intronic
1149090933 17:52778088-52778110 AGTTTTTAAAATTTGAAGCAAGG - Intergenic
1149890289 17:60383266-60383288 ACTTTTTAAAAGCTGCTGAAAGG + Intronic
1149911869 17:60574226-60574248 AGTATTTCAAAGCTGGATTCTGG - Intronic
1150492320 17:65583004-65583026 AGCTTTTAAATGCTGAAGTTGGG - Intronic
1153417433 18:4863121-4863143 TGTTTTTAAAAGCTGGATTCTGG - Intergenic
1154059776 18:11048241-11048263 ACTTTTTAAAAAATGGAGAAAGG + Intronic
1154258061 18:12802299-12802321 AGTTGTTACAAGCTACAGTATGG - Intronic
1154558082 18:15784668-15784690 AGTTTTTCAAACCTGCTGTATGG - Intergenic
1155225945 18:23729077-23729099 ACTTTTTAAAAACTTCAGTATGG - Intronic
1155269936 18:24130881-24130903 AGTTTTTAAAAGTTAAAATATGG + Intronic
1156354585 18:36330157-36330179 AGTTTTTCTAAAATGGAGTAGGG + Intronic
1157852155 18:51065125-51065147 ATTTTTTAAAATCTGGAATTTGG - Intronic
1158308686 18:56135457-56135479 AGTTTTTAAAACTTGGAGATTGG + Intergenic
1159206037 18:65253967-65253989 AGTTTTTCTAAGGTGGAGTTGGG + Intergenic
1159323056 18:66879548-66879570 AGATATTAAAATCTGGTGTATGG - Intergenic
1159475339 18:68913906-68913928 TGTTTTTAAAAGTTGGATTATGG + Intronic
1160246854 18:77166077-77166099 AGTTTGTAAGAGCTGGGGTCTGG + Intergenic
1162674932 19:12292025-12292047 AGTTTTTAAAAAATGGAATAGGG + Intronic
1163520054 19:17786750-17786772 AGTCTTTAAAAGCTGGAGGAGGG + Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1164677408 19:30110953-30110975 AGATATAAAAAGCTGGAGAAAGG + Intergenic
1165981884 19:39731268-39731290 AGTTTTAATGAGCAGGAGTAAGG + Exonic
1166161265 19:40955285-40955307 AGTTTTAAAAAGGGGGAGAAAGG + Intergenic
1166610725 19:44192692-44192714 AGTATTTTAAAGCTGGAATAAGG + Intergenic
1167771667 19:51524682-51524704 AGTTTTTAAAAAATCGACTATGG + Intronic
926640080 2:15225844-15225866 AGTTTTTTAAAGCTAGATGAAGG + Intronic
926883688 2:17577330-17577352 ATTTTTTAAAAGATGGCATATGG + Intronic
927223220 2:20735068-20735090 AGTTTTCAAAAGCTTGGTTATGG + Intronic
927229848 2:20811312-20811334 AGTTTTTAGAAGGTTGAGTCCGG - Intronic
929279318 2:40060840-40060862 AGCTATTAACAGCTGGAGGAAGG - Intergenic
930452083 2:51554631-51554653 AGTTTTCAAAAGCAGCAGGAAGG + Intergenic
931932926 2:67161113-67161135 ATTTTATAGAAGCTGGAGAAGGG - Intergenic
933406362 2:81865213-81865235 ACTTTTCAAAATCTGGAGGATGG + Intergenic
933886617 2:86723805-86723827 AGTATTTACAATCTGGAATAAGG - Intronic
933923563 2:87072900-87072922 AGTATTTACAATCTGGAATAAGG + Intergenic
935390097 2:102541988-102542010 AGTTTATAAACTCTGGAGTATGG + Intergenic
935515173 2:104027290-104027312 AGTTATTAAAAGGTGTAGTTTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936742466 2:115529922-115529944 TGTTTTTAAAATGTGGAATAAGG + Intronic
936976732 2:118228262-118228284 AGTTATTAAAAACCAGAGTAAGG - Intergenic
937197528 2:120172867-120172889 ATTTTTTAAAAACTGGAGGGTGG - Intronic
939377676 2:141390759-141390781 AGTTTTTAGGGGCTGGAGTGAGG + Intronic
939432216 2:142125493-142125515 AGTTTTTAAAAGTTGGTTTTTGG - Intronic
940113223 2:150178573-150178595 AGTGTTCAAAAGCTAAAGTATGG + Intergenic
940833075 2:158490157-158490179 ATTTTTTAAAAGGTGGATTTGGG + Intronic
941403216 2:165057366-165057388 AGTTTTTAAAAGTTGCAATGTGG + Intergenic
942395807 2:175548351-175548373 AGTTTTTAAAAAGTTGAGTGTGG + Intergenic
943021814 2:182583585-182583607 AGTTTTTAAGAGCCGGGGTGAGG - Intergenic
943169360 2:184377143-184377165 ATTTTTTAAAAGCTGCAGACTGG + Intergenic
944516754 2:200520358-200520380 TCTTTTTAAAAGCTGGATAAGGG - Intronic
945020442 2:205565725-205565747 AGTTGTTAAATGCAGGAATATGG - Intronic
945468398 2:210198362-210198384 AGTTTTTAAGACCTTGAGCATGG - Intronic
945792682 2:214325126-214325148 AGTTCTCAAAAGCTGGATTGTGG - Intronic
946027887 2:216683014-216683036 TGTTTTTAAAATCTGGAATTTGG + Intronic
946337159 2:219045566-219045588 AGTTATTAAAAGCTGGAACCAGG - Intergenic
947003506 2:225485555-225485577 AGTGTTTAAAAGCTGGACAATGG + Intronic
947777704 2:232727265-232727287 AGTTTTTAAAAGCTGTATGATGG - Intronic
947782787 2:232784684-232784706 AATTTATAAAAGCTGCAATATGG + Intronic
1169407808 20:5337964-5337986 AGTTTTTAAAGGCAGAAGAAGGG + Intergenic
1169794561 20:9447728-9447750 AGTTTTTAAGTGGTGGAGTCAGG + Intronic
1170019746 20:11823800-11823822 AGTTTTTAAGAGTTGGGATAAGG - Intergenic
1170187883 20:13611887-13611909 AGTTTTTAAAAGCTAGTCTATGG + Intronic
1171350215 20:24496143-24496165 AGTTTTTAAAAACAGAAATATGG - Intronic
1172073084 20:32272936-32272958 AGTTTTGAAAAGTCAGAGTAGGG - Intergenic
1172982110 20:38951122-38951144 AGTTTTTAAAAACTGGAAAGGGG - Intronic
1173185731 20:40838787-40838809 AGTTTGTAAAAGGTTGAGGAAGG - Intergenic
1174061130 20:47833825-47833847 AGACTTAAAAAGCTGTAGTACGG + Intergenic
1174070646 20:47896874-47896896 AGACTTAAAAAGCTGTAGTACGG - Intergenic
1174591190 20:51646445-51646467 AATTTTGAAAGGCTGGATTAGGG - Intronic
1174778091 20:53364091-53364113 AGTTTTTAAAAGATAGATCAGGG + Intronic
1175777320 20:61661535-61661557 CTTTTTTAATAGCTGGAGGAAGG + Intronic
1176412966 21:6458660-6458682 AGTTTTTAAGAGCGAGAGAATGG + Intergenic
1176815850 21:13602167-13602189 AATTTTGAAAACATGGAGTAAGG - Intergenic
1178293010 21:31385737-31385759 CGTTTTAAACAGCTGGTGTAGGG - Intronic
1179003844 21:37491622-37491644 AATTTTTAAAAATTGGAGTAGGG + Intronic
1179022148 21:37650061-37650083 TGTTTTTAAATGCTGGAATTAGG - Intronic
1182819747 22:33205358-33205380 ACTTTTTAAAAGCTGAATTAGGG - Intronic
1183881782 22:40838207-40838229 TGTAATTAAAACCTGGAGTATGG - Intronic
949386025 3:3503117-3503139 AGATTTTAAAAGATGGTCTATGG + Intergenic
950492776 3:13316338-13316360 ATTTTTCTAAAGCTGGAGAAAGG - Exonic
951061136 3:18208589-18208611 GGTTTTTAAAAGCTGGAGACTGG - Intronic
951305969 3:21062817-21062839 AGCTTCTAAAAGCTGGCCTATGG - Intergenic
951610486 3:24486979-24487001 AATTTATATAAGCTGGAGAATGG - Intronic
951722324 3:25713461-25713483 AGTTTTTAAAGGCTTGACTGGGG + Intergenic
952095121 3:29942016-29942038 AGTTTTGAGAAGCTGGTCTATGG + Intronic
952457383 3:33486319-33486341 AGATGTTAAAAGCTGAAGTCTGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953156644 3:40381181-40381203 ACTTTTTAAAAGGTGGAATAAGG + Intergenic
953614335 3:44476999-44477021 ATTTTTAAAAAGCAGTAGTATGG + Intronic
953971555 3:47352418-47352440 ATCTTTTAGAAGCTGGATTATGG + Intergenic
955076424 3:55617829-55617851 TGTTTTTAAGATCTGGAGCAAGG + Intronic
955307605 3:57849871-57849893 AGTTCTTAAAAGCAGAATTAGGG + Intronic
955705392 3:61722380-61722402 AGTTTCTAAAAGCTGAACTTTGG + Intronic
955795851 3:62636362-62636384 AGTCTTTAACAGCTGCAGTCTGG - Intronic
956589805 3:70902682-70902704 AGATTTTAAAAGGTGGGGTGTGG + Intergenic
957096431 3:75780927-75780949 AGTTTTGAAAAGGTGGACCAAGG - Intronic
957163616 3:76642029-76642051 AGTTTTTAAAAGCTGACGTAGGG + Intronic
957928361 3:86844230-86844252 AGCATTTAAGAGCTGGGGTACGG - Intergenic
957943302 3:87032359-87032381 AGTTTTTTAAACCTGGATTTAGG + Intergenic
959225405 3:103576013-103576035 AGATGTAAGAAGCTGGAGTATGG - Intergenic
959552071 3:107672553-107672575 ATTATTTAGAAGCTGAAGTAGGG + Intronic
959604269 3:108224984-108225006 AGTTTTAAAAAGCTGAGGCAGGG - Intergenic
959660212 3:108859950-108859972 AGTTTTTAAGAGCTGGGGTGGGG - Intergenic
959827655 3:110818496-110818518 ATTTTTTAAAAACTGAAGAAAGG - Intergenic
959960956 3:112297052-112297074 ATTTTTTAAAAGGTGGGGGATGG - Intergenic
961049514 3:123734560-123734582 TGTTTTTAAAAGATCGACTATGG - Intronic
961867717 3:129965968-129965990 AGGGTTTAGAGGCTGGAGTAGGG - Intergenic
964376845 3:156056239-156056261 AGTCTTTAATGGCTGGAGGAAGG - Intronic
964718078 3:159743634-159743656 AGTTGTAAAGAGCTGGAGAACGG + Intronic
964828803 3:160860155-160860177 AGATTTTAAAATCTGGACTGAGG + Intronic
965028799 3:163336277-163336299 ATTTGTTAGAAACTGGAGTAAGG - Intergenic
965122091 3:164573159-164573181 AGTCTTTAAAAGCTAAACTAAGG - Intergenic
965188498 3:165498674-165498696 TGTTTGTAAAAGCTGGTTTAGGG - Intergenic
965480884 3:169218334-169218356 AATTTTTGAAATCTGGAGGAAGG + Intronic
966101624 3:176275935-176275957 AGTAGTTAAAAGCTGGACTTTGG - Intergenic
966287170 3:178311663-178311685 AGTTTGAAGAGGCTGGAGTAAGG - Intergenic
966459211 3:180156638-180156660 AGTTTCAAAAAGCTGGAAAAGGG - Intergenic
966656023 3:182359690-182359712 AGTCTTTGCAAGCTGGAGCATGG + Intergenic
967007239 3:185395977-185395999 TGTTTTTAAAAGCTAAATTAGGG - Intronic
969214254 4:5709864-5709886 AGTTTTTAAAATGTGGTGTTTGG - Intergenic
970669950 4:18384964-18384986 AATTTTTGAAAGCTTGAATATGG + Intergenic
971439914 4:26672788-26672810 AATTTTTAAAAATTGAAGTAGGG - Intronic
971534121 4:27726833-27726855 AATTTTTTAAAGCAGCAGTATGG - Intergenic
971653039 4:29304212-29304234 AGTTCTTCCAAGCTGGAGTGAGG + Intergenic
971674256 4:29604777-29604799 TGTTTTTAAATGCTGTGGTATGG + Intergenic
971697191 4:29921369-29921391 AGTTTTTAAAAGTTGAATGAAGG + Intergenic
971939228 4:33192511-33192533 AATTTTTAAAAACTAGAGAAAGG - Intergenic
973042019 4:45480414-45480436 AATTTTTAATAAATGGAGTAAGG - Intergenic
973857588 4:55028829-55028851 AATTTTTAAAAGCAAGGGTATGG - Intergenic
974604299 4:64130673-64130695 AGTTTTCCAAAGTTGAAGTACGG - Intergenic
975540752 4:75509129-75509151 TCTTTTTAAAAGCTGTATTAAGG - Intronic
976779762 4:88746176-88746198 AATTTTTAAAAGCAGGTATAAGG - Intronic
976915710 4:90372451-90372473 CATTTTTAAAAGCTAGATTAGGG + Intronic
977708900 4:100101973-100101995 ATTTTTTAAAAAATGGAGTCAGG + Intergenic
977759480 4:100715846-100715868 AGTTTTTAAATGCTGTAGAATGG - Intronic
977938614 4:102834004-102834026 AGCTTTGAAAAGTTGGAGAATGG + Intronic
978754585 4:112288089-112288111 AATTTCTAAAAGCTTGAATAAGG + Intronic
979127194 4:116989036-116989058 AATTTTCAAAAGGTGGAGTTTGG + Intergenic
981182989 4:141767770-141767792 AGTTTTTAGGAGCTGGAGTGGGG - Intergenic
982356876 4:154480366-154480388 AGCTTTGAAAAGTTGGAGGACGG + Intronic
982854561 4:160364396-160364418 AGATTTTAAGAGCTGGAGTTGGG - Intergenic
982991721 4:162285164-162285186 AGTTTTTAAAAATATGAGTAAGG - Intergenic
985434926 4:189919427-189919449 AGTTTTTGAAAGCGAGAGTAAGG - Intergenic
986188654 5:5471780-5471802 AGTTTTTAAAATCATGAGTTAGG + Intronic
988856166 5:35229981-35230003 AGTTTGTAAAAGCTGGGGTTGGG + Intronic
989813500 5:45707575-45707597 AGTTTTAAAAACCTGGAATTAGG + Intergenic
989919610 5:49782872-49782894 AGTTTTTCAAAGCTGCTCTACGG - Intergenic
989925173 5:49864644-49864666 AGTTTTTCAAAGCTGCTCTACGG - Intergenic
990642992 5:57809299-57809321 TGTTTTTAACAGCTGGACAATGG - Intergenic
991323488 5:65403269-65403291 AGTGTTTCAAAGGTGGAGTCTGG - Intronic
991433048 5:66568282-66568304 AGGGTTTAAGAGCTGGAATAGGG - Intergenic
991588945 5:68228733-68228755 ATTATTTAAAAGGTGGAATAAGG + Intronic
992699288 5:79324665-79324687 ATTTTTTAAAAGATGAAGAATGG + Exonic
993772144 5:91941970-91941992 AGACTTTAACAGCTAGAGTAGGG - Intergenic
994363828 5:98887806-98887828 AGATTTTAAAAACTGAACTAAGG - Intronic
994632170 5:102299462-102299484 TGTTTTTAAAGGGTGGAGAATGG + Intergenic
995661170 5:114484833-114484855 AGTTTTTAAAAGCAGCTGCAGGG + Intronic
996281172 5:121730628-121730650 AGTTTTTAAACACTAGGGTAAGG - Intergenic
997139190 5:131360960-131360982 CTTTTTTAAAAGCTGGATTGTGG + Intronic
998784073 5:145689892-145689914 TGTTTAGAAAAGCTGGAGTTTGG - Intronic
999361398 5:150989359-150989381 AGCTTTTAAGAGCTAGAGTAGGG + Intergenic
1000227005 5:159272617-159272639 AGTATTTTAAAACTGGAGTCAGG - Intronic
1000599733 5:163257881-163257903 AGGTTTTAGAAGCTGGTGGAAGG - Intergenic
1002771973 6:297739-297761 AGTTATCAAAAGGTGGAGTAGGG + Intronic
1003579213 6:7324433-7324455 ATTTTTTAAAGGCTAGGGTAGGG + Intronic
1003594841 6:7465070-7465092 TGTTTTTAAAAAGTGGAGGATGG + Intergenic
1004790262 6:19018031-19018053 ACTTTTTAAAAGTTGTAATAAGG - Intergenic
1005149695 6:22734596-22734618 AGTTTTTAAGTGATGGAGAATGG + Intergenic
1005666140 6:28058471-28058493 ACTTTTTAAAAGTTGGAAGATGG - Intergenic
1005820336 6:29593344-29593366 GGTTTTTAAAGGCAGGGGTAAGG - Intronic
1006339178 6:33437108-33437130 AGTTTTTATAAGGTGGGTTAAGG + Intronic
1008038656 6:46774145-46774167 AGTTTGGCAAGGCTGGAGTATGG + Intergenic
1008068421 6:47074858-47074880 TGTTTTTAAAAGATGAAGGAGGG + Intergenic
1008701525 6:54106198-54106220 AGTTGTTTCAAGCTGGAGTGAGG + Intronic
1009449644 6:63786328-63786350 AGAATTTAATAGTTGGAGTAAGG - Intronic
1009725884 6:67535475-67535497 AGTTTTTAATAGATGTTGTATGG + Intergenic
1010486673 6:76422754-76422776 AGTTTTTAAGGGCTGGAGTGAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1012138204 6:95585478-95585500 ATTTTTTAAAAGTTTGTGTAGGG + Intronic
1012259050 6:97066685-97066707 ATTTTTTAAAGGCTGAAATAAGG - Intronic
1012886876 6:104856729-104856751 AGTGTTTAAAAGTTGGAGGCCGG - Intronic
1013012760 6:106134871-106134893 AGTTTATGAAAGCTGGAGGGTGG - Intergenic
1014603316 6:123443337-123443359 GGTTTTTAAAAGGTGGATCAGGG + Intronic
1015676843 6:135760270-135760292 GATTTTTAAAAAATGGAGTAGGG - Intergenic
1016919417 6:149276560-149276582 AGTGTTTAAAAGCTGAAGGTAGG - Intronic
1017181318 6:151555190-151555212 AGTTTTTAAAATCTGTAAAATGG + Intronic
1017265527 6:152440865-152440887 AGTTTTTAAAATCTGGAGGCAGG - Intronic
1017265654 6:152442599-152442621 AATTTTTAAAAATTGGAGTTGGG - Intronic
1017273525 6:152538072-152538094 AGTTTTTAATAGCTAGAGGTTGG - Intronic
1017549558 6:155491322-155491344 AATTTTTTCATGCTGGAGTATGG + Intergenic
1018174338 6:161165948-161165970 AGTTTTTAAAAAATGGAGTGTGG + Intronic
1018642817 6:165920357-165920379 AATTTTTGAAAGAAGGAGTAAGG - Intronic
1018693514 6:166369991-166370013 TGTTTCTAAAAACAGGAGTAGGG + Intronic
1019655248 7:2190400-2190422 AGTTTCTAAAAGCTTGGGTTAGG + Intronic
1020735148 7:11939053-11939075 AGTTTTTAAGAGCTGAGGTGTGG + Intergenic
1021674900 7:23070336-23070358 GGTTTAGTAAAGCTGGAGTAGGG + Intergenic
1022292144 7:29015161-29015183 AGTTCTTAAAAGGAGGAGGATGG - Intronic
1022564203 7:31381076-31381098 TGTTTAATAAAGCTGGAGTAGGG + Intergenic
1022710945 7:32849513-32849535 AGTTTGTAAAGGATGGATTATGG - Intergenic
1023128133 7:36975116-36975138 AGTTTTTAAAATAGGGAGTGGGG - Intronic
1023481379 7:40638531-40638553 AGGTGTTAAAAGCTTGATTAGGG + Intronic
1023776065 7:43608795-43608817 AGATATTAAAAGCTGGGGAAAGG + Intronic
1024908583 7:54419275-54419297 ACATTTTAAAAGATGGCGTAGGG - Intergenic
1027177470 7:75913996-75914018 TATTTTTAAAAGATGGAGAAGGG + Intronic
1027808809 7:82865647-82865669 AGTTTTTAAAAAATGGTGAAGGG + Intronic
1028083689 7:86610259-86610281 AGTTTTTAACAGCTTTATTAAGG - Intergenic
1028216228 7:88136953-88136975 ACTTTTTAAAAGCTGGATAATGG - Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028670189 7:93393161-93393183 GCTTTTTAAAAGCAGGATTAAGG + Intergenic
1029264985 7:99331615-99331637 ATTTTTTAAAATGTGGATTATGG + Intronic
1029835690 7:103307186-103307208 ATTTTTAAAAAGCTGGAGCTGGG - Intronic
1029900090 7:104030198-104030220 ATTTTTTAAATGTTAGAGTAGGG + Intergenic
1031486484 7:122332641-122332663 ATTTTTTAAAAGATGAAGTATGG - Intronic
1031531595 7:122883688-122883710 ATTTTTTAAAAGGTGGGGGAGGG + Intronic
1032565416 7:132937146-132937168 AGTTTATAAAAACTAGATTATGG + Intronic
1034440726 7:151084537-151084559 ATTTTTTAAAAGATGTACTATGG + Intergenic
1034720606 7:153289307-153289329 AATTTTTAAGAGCTGGGGTGGGG + Intergenic
1034753684 7:153594309-153594331 AGTTTTTAAGAGCTGGGATGGGG - Intergenic
1035772301 8:2157189-2157211 ATTTTTTAAAAGCTTGCTTATGG - Intronic
1036042725 8:5103989-5104011 ACTTTTAAAAAGCTGGAGTGGGG - Intergenic
1036947381 8:13106872-13106894 AGTTTTCAGAAGCTGTAGGAAGG + Intronic
1037424658 8:18742702-18742724 AGTGATTAAAACCTGGAGTTGGG - Intronic
1038512818 8:28156271-28156293 TGTTTTTAAAAACTGGAGTGGGG - Intronic
1039392778 8:37195298-37195320 AGTCTTTAAAAGAAGGAGTCAGG + Intergenic
1039528654 8:38239391-38239413 AGTTTTTAAAACCTGAAAAAAGG + Intronic
1039973767 8:42342691-42342713 AATTTTTAAAAACTGATGTAGGG + Intronic
1041342591 8:56861822-56861844 ATGTTTTAAAAACTGGATTATGG + Intergenic
1042438699 8:68799115-68799137 AGTCTTTAAAAGTTAGAATAGGG + Intronic
1042846663 8:73175541-73175563 AGTTTTAAAAAAATAGAGTATGG + Intergenic
1042869263 8:73382639-73382661 ATTCCTTCAAAGCTGGAGTAGGG + Intergenic
1043211255 8:77521461-77521483 ACTTTTTGAGAACTGGAGTAAGG - Intergenic
1043914921 8:85911225-85911247 AGTTTTTAAAACTAAGAGTATGG - Intergenic
1044260851 8:90118621-90118643 GGTTGTTAAATGCTGGAATAAGG - Intergenic
1044313606 8:90725320-90725342 TTTTTTTAAAAACTGGAGTGTGG - Intronic
1044972773 8:97636046-97636068 TGTTTTTAGAAACTGGAGGAAGG - Intergenic
1045161272 8:99547882-99547904 AGGTTTTAAAGGCTGCAATAAGG + Intronic
1045594926 8:103643461-103643483 TGTTATTGAAAGCTGGAGAAGGG + Intronic
1045997297 8:108378167-108378189 AGTTTTAAAAAGATGTATTAAGG + Intronic
1046582928 8:116115128-116115150 GGGTTTTAAATGCTGGAGTTTGG + Intergenic
1049856003 8:144862319-144862341 TGTTTTTAAGAGCTGAAGTAGGG + Intergenic
1050514595 9:6429956-6429978 TATTTTTAAAACCTGAAGTATGG - Intronic
1050648011 9:7742907-7742929 AGTTTTTAAAAGCTTGCATTTGG + Intergenic
1050713213 9:8489652-8489674 AGTTTAAACAGGCTGGAGTAAGG + Intronic
1050740147 9:8810665-8810687 AATATTTAAAAACTGGAGAATGG - Intronic
1051343470 9:16131741-16131763 TGTTTTTGGAAGCTGGAGAAGGG - Intergenic
1051854539 9:21548774-21548796 TGTTATTAAAAGGTGGAGTTTGG - Intergenic
1051910885 9:22153891-22153913 AGTTTTTAAAAACTGAATTTTGG - Intergenic
1051965366 9:22822195-22822217 AGTTATTAAAATTTGGAGTTAGG - Intergenic
1051974563 9:22933944-22933966 AGTTTTTAAAAGTTGGGATAGGG + Intergenic
1051984324 9:23064254-23064276 ACTTGTTAAAAACTGGAATAAGG - Intergenic
1052279268 9:26715016-26715038 AGTTTTTGAAAGCTGCATCAAGG + Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055690096 9:78820918-78820940 AGTTTATAATAGCTCTAGTAAGG + Intergenic
1055796034 9:79975866-79975888 AGGTTTTACAAGCTAGAGAAGGG + Intergenic
1055882896 9:81023287-81023309 AGTTTTCAGAAAATGGAGTAAGG + Intergenic
1056810278 9:89758452-89758474 ATTTTTTGAAAGCTGCACTAGGG - Intergenic
1056945535 9:90992448-90992470 GGATTTTGAAAACTGGAGTATGG - Intergenic
1058228374 9:102394999-102395021 AGTTTTTGAAAGCTGGAGTTGGG + Intergenic
1058282481 9:103132425-103132447 AGTACTTAAAAGATGGAGTGGGG - Intergenic
1059872646 9:118595148-118595170 AGTTTTTAAAAAAGGGAGAATGG - Intergenic
1203531508 Un_GL000213v1:147294-147316 AATTTTGAAAACATGGAGTAAGG + Intergenic
1186562969 X:10632470-10632492 AGTTTTTAAAAGCTACCTTAGGG + Intronic
1186724658 X:12344426-12344448 AGATTTTAAAAAGTGGAGGAGGG - Intronic
1187478594 X:19634390-19634412 AGTGTTCTAAAGCTGGATTATGG - Intronic
1188661735 X:32768823-32768845 ATACTTTAAAAGCTGGAGAAAGG - Intronic
1188692272 X:33144788-33144810 ACTTTTTAGATGGTGGAGTAAGG - Intronic
1188908257 X:35813870-35813892 TGGTTTTAAATGCTGGAGAATGG - Intergenic
1192328395 X:70153418-70153440 AGTTTTTAAAAACTGGGTTGAGG - Intronic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1194056537 X:89141428-89141450 AGTTTCCAAAAGCTGGAGACAGG - Intergenic
1195574708 X:106436925-106436947 AAATTTTAAAAGCTGTACTAAGG + Intergenic
1196766388 X:119249099-119249121 AGCATTTAAAAGCTTGAGCAGGG + Intergenic
1198127980 X:133666073-133666095 TGGTTTTGGAAGCTGGAGTACGG - Intronic
1198463556 X:136884925-136884947 CCTTTTTAAGAGGTGGAGTAAGG + Intergenic
1198468517 X:136924775-136924797 AGTTTTTAAAAATTGGTGCATGG + Intergenic
1198516758 X:137416397-137416419 AGTATCTAAAAGCAGAAGTAGGG + Intergenic
1199033712 X:143028894-143028916 AGCTTTTAAAAGCTGGAGTAGGG + Intronic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1199093733 X:143717651-143717673 AGTTTTTAAAAGCTGGAGTAGGG - Intronic
1199214603 X:145250510-145250532 TGTTTTTAAAAGCTGGAGTAGGG + Intronic
1199323198 X:146465490-146465512 AGTTTTGAACAGTTTGAGTAGGG - Intergenic
1199924575 X:152449470-152449492 TGTTTTTAAAAGGTGCAGTTTGG + Intronic
1201863679 Y:18626444-18626466 AGTGTTTAAAAGGTGGGTTAAGG + Intergenic
1201869643 Y:18693934-18693956 AGTGTTTAAAAGGTGGGTTAAGG - Intergenic
1202039399 Y:20666643-20666665 AAACTTTAAAAACTGGAGTATGG + Intergenic