ID: 1199094752

View in Genome Browser
Species Human (GRCh38)
Location X:143726134-143726156
Sequence TCCTGAGTCAGGTGGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3735
Summary {0: 44, 1: 349, 2: 1240, 3: 1151, 4: 951}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199094752_1199094765 20 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094765 X:143726177-143726199 TGGATCCCACGCTAGGGCCGTGG No data
1199094752_1199094762 13 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094762 X:143726170-143726192 CACCTAGTGGATCCCACGCTAGG No data
1199094752_1199094763 14 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094752_1199094758 0 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094758 X:143726157-143726179 GCCCCGCTGGCTTCACCTAGTGG No data
1199094752_1199094766 21 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094766 X:143726178-143726200 GGATCCCACGCTAGGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199094752 Original CRISPR TCCTGAGTCAGGTGGGGACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr