ID: 1199094753

View in Genome Browser
Species Human (GRCh38)
Location X:143726140-143726162
Sequence CGGGGCTCCTGAGTCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199094753_1199094762 7 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094762 X:143726170-143726192 CACCTAGTGGATCCCACGCTAGG No data
1199094753_1199094763 8 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094753_1199094758 -6 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094758 X:143726157-143726179 GCCCCGCTGGCTTCACCTAGTGG No data
1199094753_1199094765 14 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094765 X:143726177-143726199 TGGATCCCACGCTAGGGCCGTGG No data
1199094753_1199094766 15 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094766 X:143726178-143726200 GGATCCCACGCTAGGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199094753 Original CRISPR CGGGGCTCCTGAGTCAGGTG GGG (reversed) Intergenic
No off target data available for this crispr