ID: 1199094757

View in Genome Browser
Species Human (GRCh38)
Location X:143726145-143726167
Sequence GCCAGCGGGGCTCCTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2343
Summary {0: 12, 1: 1027, 2: 555, 3: 325, 4: 424}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199094757_1199094763 3 Left 1199094757 X:143726145-143726167 CCTGACTCAGGAGCCCCGCTGGC 0: 12
1: 1027
2: 555
3: 325
4: 424
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094757_1199094765 9 Left 1199094757 X:143726145-143726167 CCTGACTCAGGAGCCCCGCTGGC 0: 12
1: 1027
2: 555
3: 325
4: 424
Right 1199094765 X:143726177-143726199 TGGATCCCACGCTAGGGCCGTGG No data
1199094757_1199094762 2 Left 1199094757 X:143726145-143726167 CCTGACTCAGGAGCCCCGCTGGC 0: 12
1: 1027
2: 555
3: 325
4: 424
Right 1199094762 X:143726170-143726192 CACCTAGTGGATCCCACGCTAGG No data
1199094757_1199094766 10 Left 1199094757 X:143726145-143726167 CCTGACTCAGGAGCCCCGCTGGC 0: 12
1: 1027
2: 555
3: 325
4: 424
Right 1199094766 X:143726178-143726200 GGATCCCACGCTAGGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199094757 Original CRISPR GCCAGCGGGGCTCCTGAGTC AGG (reversed) Intergenic
Too many off-targets to display for this crispr