ID: 1199094759

View in Genome Browser
Species Human (GRCh38)
Location X:143726158-143726180
Sequence TCCACTAGGTGAAGCCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199094759_1199094766 -3 Left 1199094759 X:143726158-143726180 CCCCGCTGGCTTCACCTAGTGGA No data
Right 1199094766 X:143726178-143726200 GGATCCCACGCTAGGGCCGTGGG No data
1199094759_1199094765 -4 Left 1199094759 X:143726158-143726180 CCCCGCTGGCTTCACCTAGTGGA No data
Right 1199094765 X:143726177-143726199 TGGATCCCACGCTAGGGCCGTGG No data
1199094759_1199094763 -10 Left 1199094759 X:143726158-143726180 CCCCGCTGGCTTCACCTAGTGGA No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199094759 Original CRISPR TCCACTAGGTGAAGCCAGCG GGG (reversed) Intergenic
No off target data available for this crispr