ID: 1199094763

View in Genome Browser
Species Human (GRCh38)
Location X:143726171-143726193
Sequence ACCTAGTGGATCCCACGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199094753_1199094763 8 Left 1199094753 X:143726140-143726162 CCCCACCTGACTCAGGAGCCCCG No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094757_1199094763 3 Left 1199094757 X:143726145-143726167 CCTGACTCAGGAGCCCCGCTGGC 0: 12
1: 1027
2: 555
3: 325
4: 424
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094750_1199094763 17 Left 1199094750 X:143726131-143726153 CCTCCAAGTCCCCACCTGACTCA No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094755_1199094763 6 Left 1199094755 X:143726142-143726164 CCACCTGACTCAGGAGCCCCGCT No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094752_1199094763 14 Left 1199094752 X:143726134-143726156 CCAAGTCCCCACCTGACTCAGGA 0: 44
1: 349
2: 1240
3: 1151
4: 951
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094759_1199094763 -10 Left 1199094759 X:143726158-143726180 CCCCGCTGGCTTCACCTAGTGGA No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data
1199094754_1199094763 7 Left 1199094754 X:143726141-143726163 CCCACCTGACTCAGGAGCCCCGC No data
Right 1199094763 X:143726171-143726193 ACCTAGTGGATCCCACGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199094763 Original CRISPR ACCTAGTGGATCCCACGCTA GGG Intergenic
No off target data available for this crispr