ID: 1199106005

View in Genome Browser
Species Human (GRCh38)
Location X:143869197-143869219
Sequence TTGTGGTTGTGGTGGTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199106005_1199106009 -8 Left 1199106005 X:143869197-143869219 CCTTATCACCACCACAACCACAA No data
Right 1199106009 X:143869212-143869234 AACCACAACAGAAAAGATAAGGG No data
1199106005_1199106008 -9 Left 1199106005 X:143869197-143869219 CCTTATCACCACCACAACCACAA No data
Right 1199106008 X:143869211-143869233 CAACCACAACAGAAAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199106005 Original CRISPR TTGTGGTTGTGGTGGTGATA AGG (reversed) Intergenic
No off target data available for this crispr