ID: 1199110539

View in Genome Browser
Species Human (GRCh38)
Location X:143928792-143928814
Sequence CAGGTGCCCACCACCACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228284
Summary {0: 2607, 1: 15321, 2: 42780, 3: 74393, 4: 93183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110539_1199110541 -5 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110541 X:143928810-143928832 ACCTGTAGTCCCAGCTACCCGGG 0: 490
1: 31317
2: 154407
3: 250957
4: 216009
1199110539_1199110543 -2 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110543 X:143928813-143928835 TGTAGTCCCAGCTACCCGGGAGG 0: 620
1: 59172
2: 183464
3: 270391
4: 188837
1199110539_1199110545 4 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110545 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1350
1: 106333
2: 284896
3: 224325
4: 126985
1199110539_1199110540 -6 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110540 X:143928809-143928831 CACCTGTAGTCCCAGCTACCCGG 0: 759
1: 30256
2: 104929
3: 131493
4: 151438
1199110539_1199110547 8 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110547 X:143928823-143928845 GCTACCCGGGAGGCTGAGGCAGG 0: 1152
1: 94742
2: 243306
3: 199594
4: 126630
1199110539_1199110552 27 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110539_1199110550 15 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110550 X:143928830-143928852 GGGAGGCTGAGGCAGGAGAATGG 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
1199110539_1199110551 20 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110551 X:143928835-143928857 GCTGAGGCAGGAGAATGGTGTGG 0: 79
1: 303
2: 387
3: 1936
4: 5874
1199110539_1199110553 28 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110539 Original CRISPR CAGGTGCCCACCACCACGCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr