ID: 1199110542

View in Genome Browser
Species Human (GRCh38)
Location X:143928811-143928833
Sequence TCCCGGGTAGCTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 703220
Summary {0: 648, 1: 59350, 2: 182744, 3: 269437, 4: 191041}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110542_1199110553 9 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data
1199110542_1199110555 15 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG No data
1199110542_1199110550 -4 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110550 X:143928830-143928852 GGGAGGCTGAGGCAGGAGAATGG 0: 61556
1: 45979
2: 19513
3: 9543
4: 8794
1199110542_1199110551 1 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110551 X:143928835-143928857 GCTGAGGCAGGAGAATGGTGTGG 0: 79
1: 303
2: 387
3: 1936
4: 5874
1199110542_1199110554 12 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG No data
1199110542_1199110552 8 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110542 Original CRISPR TCCCGGGTAGCTGGGACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr