ID: 1199110544

View in Genome Browser
Species Human (GRCh38)
Location X:143928819-143928841
Sequence CCTCAGCCTCCCGGGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 749586
Summary {0: 1384, 1: 109035, 2: 293638, 3: 223658, 4: 121871}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110544_1199110551 -7 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110551 X:143928835-143928857 GCTGAGGCAGGAGAATGGTGTGG 0: 79
1: 303
2: 387
3: 1936
4: 5874
1199110544_1199110553 1 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data
1199110544_1199110554 4 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG No data
1199110544_1199110555 7 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG No data
1199110544_1199110552 0 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110544 Original CRISPR CCTCAGCCTCCCGGGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr