ID: 1199110546

View in Genome Browser
Species Human (GRCh38)
Location X:143928820-143928842
Sequence GCCTCAGCCTCCCGGGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 720162
Summary {0: 1251, 1: 102490, 2: 265898, 3: 217484, 4: 133039}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110546_1199110555 6 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG No data
1199110546_1199110551 -8 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110551 X:143928835-143928857 GCTGAGGCAGGAGAATGGTGTGG 0: 79
1: 303
2: 387
3: 1936
4: 5874
1199110546_1199110554 3 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG No data
1199110546_1199110552 -1 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110546_1199110553 0 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110546 Original CRISPR GCCTCAGCCTCCCGGGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr