ID: 1199110548

View in Genome Browser
Species Human (GRCh38)
Location X:143928827-143928849
Sequence TTCTCCTGCCTCAGCCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24505
Summary {0: 3953, 1: 5516, 2: 4741, 3: 4253, 4: 6042}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110548_1199110552 -8 Left 1199110548 X:143928827-143928849 CCCGGGAGGCTGAGGCAGGAGAA 0: 3953
1: 5516
2: 4741
3: 4253
4: 6042
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110548_1199110553 -7 Left 1199110548 X:143928827-143928849 CCCGGGAGGCTGAGGCAGGAGAA 0: 3953
1: 5516
2: 4741
3: 4253
4: 6042
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data
1199110548_1199110554 -4 Left 1199110548 X:143928827-143928849 CCCGGGAGGCTGAGGCAGGAGAA 0: 3953
1: 5516
2: 4741
3: 4253
4: 6042
Right 1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG No data
1199110548_1199110555 -1 Left 1199110548 X:143928827-143928849 CCCGGGAGGCTGAGGCAGGAGAA 0: 3953
1: 5516
2: 4741
3: 4253
4: 6042
Right 1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110548 Original CRISPR TTCTCCTGCCTCAGCCTCCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr