ID: 1199110549

View in Genome Browser
Species Human (GRCh38)
Location X:143928828-143928850
Sequence ATTCTCCTGCCTCAGCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13049
Summary {0: 3037, 1: 2994, 2: 2314, 3: 2169, 4: 2535}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110549_1199110553 -8 Left 1199110549 X:143928828-143928850 CCGGGAGGCTGAGGCAGGAGAAT 0: 3037
1: 2994
2: 2314
3: 2169
4: 2535
Right 1199110553 X:143928843-143928865 AGGAGAATGGTGTGGAACCCGGG No data
1199110549_1199110555 -2 Left 1199110549 X:143928828-143928850 CCGGGAGGCTGAGGCAGGAGAAT 0: 3037
1: 2994
2: 2314
3: 2169
4: 2535
Right 1199110555 X:143928849-143928871 ATGGTGTGGAACCCGGGAGGCGG No data
1199110549_1199110554 -5 Left 1199110549 X:143928828-143928850 CCGGGAGGCTGAGGCAGGAGAAT 0: 3037
1: 2994
2: 2314
3: 2169
4: 2535
Right 1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG No data
1199110549_1199110552 -9 Left 1199110549 X:143928828-143928850 CCGGGAGGCTGAGGCAGGAGAAT 0: 3037
1: 2994
2: 2314
3: 2169
4: 2535
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110549 Original CRISPR ATTCTCCTGCCTCAGCCTCC CGG (reversed) Intergenic
Too many off-targets to display for this crispr