ID: 1199110552

View in Genome Browser
Species Human (GRCh38)
Location X:143928842-143928864
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199110539_1199110552 27 Left 1199110539 X:143928792-143928814 CCGGGCGTGGTGGTGGGCACCTG 0: 2607
1: 15321
2: 42780
3: 74393
4: 93183
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110548_1199110552 -8 Left 1199110548 X:143928827-143928849 CCCGGGAGGCTGAGGCAGGAGAA 0: 3953
1: 5516
2: 4741
3: 4253
4: 6042
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110546_1199110552 -1 Left 1199110546 X:143928820-143928842 CCAGCTACCCGGGAGGCTGAGGC 0: 1251
1: 102490
2: 265898
3: 217484
4: 133039
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110549_1199110552 -9 Left 1199110549 X:143928828-143928850 CCGGGAGGCTGAGGCAGGAGAAT 0: 3037
1: 2994
2: 2314
3: 2169
4: 2535
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110542_1199110552 8 Left 1199110542 X:143928811-143928833 CCTGTAGTCCCAGCTACCCGGGA 0: 648
1: 59350
2: 182744
3: 269437
4: 191041
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data
1199110544_1199110552 0 Left 1199110544 X:143928819-143928841 CCCAGCTACCCGGGAGGCTGAGG 0: 1384
1: 109035
2: 293638
3: 223658
4: 121871
Right 1199110552 X:143928842-143928864 CAGGAGAATGGTGTGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199110552 Original CRISPR CAGGAGAATGGTGTGGAACC CGG Intergenic
No off target data available for this crispr