ID: 1199114949

View in Genome Browser
Species Human (GRCh38)
Location X:143980781-143980803
Sequence CTGCACGTGCAAAATGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199114944_1199114949 3 Left 1199114944 X:143980755-143980777 CCCTGCACATAATGAAAAGTCCA No data
Right 1199114949 X:143980781-143980803 CTGCACGTGCAAAATGTGGCAGG No data
1199114945_1199114949 2 Left 1199114945 X:143980756-143980778 CCTGCACATAATGAAAAGTCCAA No data
Right 1199114949 X:143980781-143980803 CTGCACGTGCAAAATGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199114949 Original CRISPR CTGCACGTGCAAAATGTGGC AGG Intergenic
No off target data available for this crispr