ID: 1199120606

View in Genome Browser
Species Human (GRCh38)
Location X:144048663-144048685
Sequence TTGGGGAAACAGGTGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199120606_1199120612 25 Left 1199120606 X:144048663-144048685 CCAAGCACCACCTGTTTCCCCAA No data
Right 1199120612 X:144048711-144048733 TAAAAAAACTGTCATCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199120606 Original CRISPR TTGGGGAAACAGGTGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr