ID: 1199121413

View in Genome Browser
Species Human (GRCh38)
Location X:144058754-144058776
Sequence TACACATGTGTGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1199121411_1199121413 21 Left 1199121411 X:144058710-144058732 CCATGTTTTTATCTTAGCACTTA No data
Right 1199121413 X:144058754-144058776 TACACATGTGTGTTTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1199121413 Original CRISPR TACACATGTGTGTTTCTCAC TGG Intergenic
No off target data available for this crispr